AtREG361 | LIMITED TIME OFFER !

Organization Arabidopsis thaliana ID AtREG361 Sequence AATGGGCC Annotation PPDB pattern GCCCA Element II of Arabidopsis PCNA-2, cell cycle / meristematic expression PLACE Motif GGGCC one of the "over-represented sequences in light-induced promoters (SORLIP) in Arabidopsis; PhyA-induced patterns identified by calculation; see also S000482, S000484, S000485, S000486 (all SORLIPs), as well as S000487, S000488, S000488. , S000489, SORLREP); TGGGCY "Site II Element" present in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 translational departure sites (Welchen et al., 2005); Y = C / T; See also S000308; Overrepresented in promoters of nuclear genes encoding the components of oxidative phosphorylation machinery (OxPhos) of Arabidopsis and rice (Welchen and Gonzalez, 2006); Total number of entries 1133
Place Gene model Sequence The description AT1G01080 AT1G01080.1 gAATGGGCCAT 33 kDa ribonucleoprotein, chloroplast, putative / cp33 RNA binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS InterPro DOMAIN / S: RNA recognition pattern, RNP-1 (InterPro: IPR000504), nucleotide binding, alpha-beta braid (InterPro: IPR012677); The BEST protein match with Arabidopsis thaliana is: CP33; RNA binding (TAIR: AT3G52380.1); A 17909 shots at 11804 proteins in 598 species: Archae – 16; Bacteria – 1315; Metazoa – 10536; Mushrooms – 1741; Plants – 2530; Virus – 0; Other eukaryotes – 1771 (source: NCBI BLink). & Nbsp AT1G01080.2 gAATGGGCCAT 33 kDa ribonucleoprotein, chloroplast, putative / cp33 RNA binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS InterPro DOMAIN / S: RNA recognition pattern, RNP-1 (InterPro: IPR000504), nucleotide binding, alpha-beta braid (InterPro: IPR012677); The BEST protein match with Arabidopsis thaliana is: CP33; RNA binding (TAIR: AT3G52380.1); A 17909 shots at 11804 proteins in 598 species: Archae – 16; Bacteria – 1315; Metazoa – 10536; Mushrooms – 1741; Plants – 2530; Virus – 0; Other eukaryotes – 1771 (source: NCBI BLink). & Nbsp AT1G01100 AT1G01100.1 AAATGGGCCLABEL 60S P1 Acid Ribosomal Protein (RPP1A); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (s) InterPro: 60S ribosomal protein (InterPro: IPR001813); BEST protein correlation with Arabidopsis thaliana is: P1 protein (RPP1C) ribosomal acid 60S (TAIR: AT5G47700.2); At 1664 strokes at 1663 proteins in 290 species: Archae – 48; Bacteria – 0; Metazoa – 686; Mushrooms – 343; Plants – 315; Virus – 0; Other eukaryotes – 272 (source: NCBI BLink). & Nbsp AT1G01100.2 AAATGGGCCLABEL 60S P1 Acid Ribosomal Protein (RPP1A); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (s) InterPro: 60S ribosomal protein (InterPro: IPR001813); BEST protein correlation with Arabidopsis thaliana is: P1 protein (RPP1C) ribosomal acid 60S (TAIR: AT5G47700.2); At 1664 strokes at 1663 proteins in 290 species: Archae – 48; Bacteria – 0; Metazoa – 686; Mushrooms – 343; Plants – 315; Virus – 0; Other eukaryotes – 272 (source: NCBI BLink). & Nbsp AT1G01100.3 AAATGGGCCLABEL 60S P1 Acid Ribosomal Protein (RPP1A); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (s) InterPro: 60S ribosomal protein (InterPro: IPR001813); BEST protein correlation with Arabidopsis thaliana is: P1 protein (RPP1C) ribosomal acid 60S (TAIR: AT5G47700.2); At 1664 strokes at 1663 proteins in 290 species: Archae – 48; Bacteria – 0; Metazoa – 686; Mushrooms – 343; Plants – 315; Virus – 0; Other eukaryotes – 272 (source: NCBI BLink). & Nbsp AT1G01100.4 AAATGGGCCLABEL 60S P1 Acid Ribosomal Protein (RPP1A); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (s) InterPro: 60S ribosomal protein (InterPro: IPR001813); BEST protein correlation with Arabidopsis thaliana is: P1 protein (RPP1C) ribosomal acid 60S (TAIR: AT5G47700.2); At 1664 strokes at 1663 proteins in 290 species: Archae – 48; Bacteria – 0; Metazoa – 686; Mushrooms – 343; Plants – 315; Virus – 0; Other eukaryotes – 272 (source: NCBI BLink). & Nbsp AT1G01320 AT1G01320.1 CTTAGGCCCATTAA a protein containing a tetratricopeptide (TPR) repeat; FUNCTIONS IN: binding; LOCATED IN: Unknown cell_compound EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (S) InterPro: tetratricopeptide-like helical (InterPro: IPR011990), tetratricopeptide TPR2 (InterPro: IPR013105), tetratricopeptide region (InterPro: IPR013026); The BEST protein match with Arabidopsis thaliana is: binding (TAIR: AT4G28080.1); At 10077 blasts at 4062 proteins in 343 species: Archae – 100; Bacteria – 2124; Metazoa – 5307; Mushrooms – 1095; Plants – 343; Virus – 76; Other eukaryotes – 1032 (source: NCBI BLink). & Nbsp AT1G01350 AT1G01350.1 gGGCCCATTAT nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS FIELD (S) InterPro: Zinc finger, type CCCH (InterPro: IPR000571), zinc finger, type RING, site preserved (InterPro: IPR017907), zinc finger, Type RING (InterPro: IPR001841), zinc finger, RING / Type FYVE / PHD (InterPro: IPR013083); BEST protein pairing with Arabidopsis thaliana is as follows: Zinc finger family protein (CCCH / C3HC4 type RING fingers) (TAIR: AT5G06420.2); A 684 chips with 680 proteins in 163 species: Archae – 0; Bacteria 2; Metazoa – 306; Mushrooms – 148; Plants – 91; Virus – 0; Other eukaryotes – 137 (source: NCBI BLink). & Nbsp AT1G01710 AT1G01710.1 TTAATGGGCCTTG the family of the acyl-CoA thioesterase family; FUNCTIONS IN: cyclic nucleotide linkage, acyl-CoA thioesterase activity; INVOLVED IN: the metabolic process of acyl-CoA; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (S) InterPro: cyclic nucleotide linkage (InterPro: IPR000595), cyclic nucleotide link analog (InterPro: IPR018490), Acyl-CoA thioesterase (InterPro: IPR003703), jmlr like fold (InterPro: IPR014710); The BEST protein correlation with Arabidopsis thaliana is as follows: protein of the family of acio-CoA thioesterases (TAIR: AT4G00520.2); At 2588 breaths at 2566 proteins in 602 species: Archae – 0; Bacteria – 1102; Metazoans – 404; Mushrooms – 233; Plants – 38; Virus – 0; Other eukaryotes – 811 (source: NCBI BLink). & Nbsp AT1G01970 AT1G01970.1 ATAATGGGCCAT a protein containing a pentatricopeptide (PPR) repeat; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (s) InterPro: Pentatricopeptide Repeat (InterPro: IPR002885); The BEST protein match with Arabidopsis thaliana is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR: AT1G19520.1); At 7256 breaths at 3017 proteins in 95 species: Archae – 0; Bacteria – 0; Metazoans – 83; Mushrooms – 5; Plants – 6997; Virus – 0; Other eukaryotes – 171 (source: NCBI BLink). & Nbsp AT1G02290 AT1G02290.1 TATAGGCCCATTC unknown protein; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound The BEST protein match with Arabidopsis thaliana is as follows: unknown protein (TAIR: AT3G45830.1); 80 explosive strikes for 80 proteins in 23 species: Archae – 0; Bacteria – 0; Metazoans – 43; Mushrooms – 0; Plants – 35; Virus – 0; Other eukaryotes – 2 (source: NCBI BLink). & Nbsp AT1G02560 AT1G02560.1 TTGGCCCATTT One of several ClpPs (caseinolytic protease) nuclear coding. Contains a highly conserved triad of Ser-His-Asp proteases. The name reflects the nomenclature described in Adam and. al (2001). & nbsp AT1G02680 AT1G02680.1 YOURAATGGGCCTATT FACTOR 13 ASSOCIATED WITH PCT (TAF13); FUNCTIONS IN: Activity of the transcription factor of RNA polymerase II, binding to DNA; INVOLVED IN: initiation of transcription, transcription from the RNA polymerase II promoter; LOCATED IN: complex transcription factors; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE / s InterPro: transcription initiation IID factor, 18 kDa subunit (InterPro: IPR003195), histone fold (InterPro: IPR009072); A 401 Blast strikes at 401 proteins in 119 species: Archae – 0; Bacteria – 0; Metazoans – 182; Mushrooms – 191; Plants – 19; Virus – 2; Other eukaryotes – 7 (source: NCBI BLink). & Nbsp AT1G03090 AT1G03090.1 ATGGCCCATTAA MCCA is the biotinylated subunit of the MCCase dimer, involved in the degradation of leucine. Both subunits have a nuclear code and the active enzyme is located in the mitochondria. & Nbsp AT1G03090.2 ATGGCCCATTAA MCCA is the biotinylated subunit of the MCCase dimer, involved in the degradation of leucine. Both subunits have a nuclear code and the active enzyme is located in the mitochondria. & Nbsp AT1G03106 AT1G03106.1 TTATGGGCCCATTg unknown protein; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound At 2 breaths to 2 proteins in 1 species: Archae – 0; Bacteria – 0; Metazoa – 0; Mushrooms – 0; Plants – 2; Virus – 0; Other eukaryotes – 0 (source: NCBI BLink). & Nbsp AT1G03110 AT1G03110.1 CAATGGGCCCATAA transducin family protein / repeat family protein WD-40; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 stages of growth; CONTAINS DOMAINE / s InterPro: WD40 repetition type (InterPro: IPR011046), WD40 repeater, region (InterPro: IPR017986), WD40 / YVTN repetition type (InterPro: IPR015943), WD40 repetition (InterPro: IPR001680); The BEST protein match with Arabidopsis thaliana is: p80 protein subunit of the WD-40 repeated / katanine family, putative (TAIR: AT1G61210.1); At 10142 breath shots at 5991 proteins in 342 species: Archae – 38; Bacteria – 2987; Metazoa – 3498; Mushrooms – 1909; Plants – 650; Virus – 0; Other eukaryotes – 1060 (source: NCBI BLink). & Nbsp AT1G03350 AT1G03350.1 TGGCCCATTAA Protein containing the BSD domain; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 stages of growth; CONTAINS DOMAINE / s InterPro: BSD (InterPro: IPR005607); The BEST protein correlation with Arabidopsis thaliana is as follows: protein containing the BSD domain (TAIR: AT4G13110.1); At 9675 breaths at 5119 proteins in 484 species: Archae – 40; Bacteria – 3294; Metazoa – 2852; Mushrooms – 1070; Plants – 279; Virus – 71; Other eukaryotes – 2069 (source: NCBI BLink). & Nbsp AT1G03350.1 TGGCCCATTYOUR Protein containing the BSD domain; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 stages of growth; CONTAINS DOMAINE / s InterPro: BSD (InterPro: IPR005607); The BEST protein correlation with Arabidopsis thaliana is as follows: protein containing the BSD domain (TAIR: AT4G13110.1); At 9675 breaths at 5119 proteins in 484 species: Archae – 40; Bacteria – 3294; Metazoa – 2852; Mushrooms – 1070; Plants – 279; Virus – 71; Other eukaryotes – 2069 (source: NCBI BLink). & Nbsp AT1G03360 AT1G03360.1 YOURAATGGGCCA ARABIDOPSIS THALIANA RIBOSOMAL RNA TREATMENT 4 (ATRRP4); FUNCTIONS IN: binding to RNA, exonuclease activity; LOCATED IN: mitochondria; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (s) InterPro: nucleic acid binding, similar to OB folding (InterPro: IPR016027), S1, RNA binding (InterPro: IPR003029); A 443 Blast strikes 443 proteins in 204 species: Archae – 97; Bacteria – 0; Metazoans – 111; Mushrooms – 87; Plants – 23; Virus – 0; Other eukaryotes – 125 (source: NCBI BLink). & Nbsp AT1G03360.1 TTAATGGGCCA ARABIDOPSIS THALIANA RIBOSOMAL RNA TREATMENT 4 (ATRRP4); FUNCTIONS IN: binding to RNA, exonuclease activity; LOCATED IN: mitochondria; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (s) InterPro: nucleic acid binding, similar to OB folding (InterPro: IPR016027), S1, RNA binding (InterPro: IPR003029); A 443 Blast strikes 443 proteins in 204 species: Archae – 97; Bacteria – 0; Metazoans – 111; Mushrooms – 87; Plants – 23; Virus – 0; Other eukaryotes – 125 (source: NCBI BLink). & Nbsp AT1G03860 AT1G03860.1 AAATGGGCCTCT prohibition in 2 & nbsp AT1G03860.1 ATAATGGGCCTGA prohibition in 2 & nbsp AT1G03860.1 TAATGGGCCTAAG prohibition in 2 & nbsp AT1G03860.2 AAATGGGCCTCT prohibition in 2 & nbsp AT1G03860.2 ATAATGGGCCTGA prohibition in 2 & nbsp AT1G03860.2 TAATGGGCCTAAG prohibition in 2 & nbsp AT1G03860.3 AAATGGGCCTCT prohibition in 2 & nbsp AT1G03860.3 ATAATGGGCCTGA prohibition in 2 & nbsp AT1G03860.3 TAATGGGCCTAAG prohibition in 2 & nbsp AT1G04070 AT1G04070.1 CTTAATGGGCCTAC Subunit of the TOM complex, a translocase located in the outer mitochondrial membrane that selectively allows proteins associated with a mitochondrial targeting sequence to enter the mitochondria. & Nbsp AT1G04080 AT1G04080.1 GTAGGCCCATTAAG PRP39; FUNCTIONS IN: binding; INCLUDED IN: regulation of the moment of transition from the vegetative phase to the reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 factory structures; EXPRESSED DURING: 13 stages of growth; CONTAINS InterPro DOMAIN / s: RNA processing protein, HAT helix (InterPro: IPR003107), helical tetratricopeptide-like helix (InterPro: IPR011990); The BEST protein match with Arabidopsis thaliana is: PRP39-2 (TAIR: AT5G46400.1); A 3312 Blast hits at 2661 proteins in 380 species: Archae – 0; Bacteria – 496; Metazoa – 1500; Mushrooms – 623; Plants – 264; Virus – 71; Other eukaryotes – 358 (source: NCBI BLink). & Nbsp AT1G04190 AT1G04190.1 TGAGGCCCATTYOUR a protein containing a tetratricopeptide (TPR) repeat; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (S) InterPro: tetratricopeptide TPR-1 (InterPro: IPR001440), helical tetratricopeptide type (InterPro: IPR011990), tetratricopeptide region (InterPro: IPR013026); BEST protein correlation with Arabidopsis thaliana is as follows: putative stress-inducible protein (TAIR: AT1G62740.1); A 15524 hits to 9686 proteins in 698 species: Archae – 779; Bacteria – 4552; Metazoa – 3572; Mushrooms – 847; Plants – 951; Virus – 0; Other eukaryotes – 4823 (source: NCBI BLink). & Nbsp AT1G04260 AT1G04260.1 TTAATGGGCCTTTAA Encodes a protein that interacts with the CaMV motion protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as rat PRA1) described as rab acceptors. & Nbsp AT1G04410 AT1G04410.1 AGMGGCCCATTAG malate dehydrogenase, cytosolic, putative; IN FUNCTIONS: in 6 functions; INVOLVED IN: response to cadmium ion, salt stress response; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 stages of growth; CONTAINS DOMAINE (S) InterPro: malate dehydrogenase, NAD-dependent, cytosolic (InterPro: IPR011274), lactate / malate dehydrogenase (InterPro: IPR001236), malate dehydrogenase, NAD or NADP (InterPro: IPR010945), NAD (P): IPR016040) , L-lactate / malate dehydrogenase (InterPro: IPR001557), Malate dehydrogenase, active site (InterPro: IPR001252), Lactate dehydrogenase / glycoside hydrolase, family 4, Terminal C (InterPro: IPR015955); BEST protein correlation with Arabidopsis thaliana is: malate dehydrogenase, cytosolic, putative (TAIR: AT5G43330.1); At 7871 Blast strikes at 7869 proteins in 1725 species: Archae – 115; Bacteria – 3866; Metazoans – 1047; Mushrooms – 188; Plants – 460; Virus – 0; Other eukaryotes – 2195 (source: NCBI BLink). & Nbsp AT1G04420 AT1G04420.1 CTAATGGGCCTCT the family of the aldo / keto reductase family; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: reduction of oxidation; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE / s InterPro: Aldo / keto reductase (InterPro: IPR001395); The BEST protein match with Arabidopsis thaliana is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); Oxidoreductase / potassium channel (TAIR: AT1G04690.1); At 17,372 breaths to 17,351 proteins in 1400 species: Archae – 300; Bacteria – 9458; Metazoa – 1333; Mushrooms – 1228; Plants – 519; Virus – 0; Other eukaryotes – 4534 (source: NCBI BLink). & Nbsp AT1G04510 AT1G04510.1 YYYYGGCCCATTT transducin family protein / repeat family protein WD-40; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: the response to cadmium ion; LOCATED IN: the nucleolus, the CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAIN / s: InterPro type WD40 (InterPro: IPR011046), Zone U (InterPro: IPR003613), Repetition of WD40, region (InterPro: IPR017986), Zinc finger, RING / FYVE / PHD-type (InterPro: IPR013083), WD40 Repetition (InterPro: IPR001680), WD40 / YVTN Repetition (InterPro: IPR015943), 19 mRNA Pre-Splicing Factor (InterPro: IPR013915); The BEST Arabidopsis thaliana protein match is as follows: nucleotide / protein ubiquitin-protein ligase binding (TAIR: AT2G33340.2); Has 39753 Blast strikes up to 19409 protein in 575 species: Archae – 62; Bacteria – 5219; Metazoa – 17707; Mushrooms – 7589; Plants – 3300; Virus – 0; Other eukaryotes – 5876 (source: NCBI BLink). & Nbsp AT1G04510.2 YYYYGGCCCATTT transducin family protein / repeat family protein WD-40; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: the response to cadmium ion; LOCATED IN: the nucleolus, the CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAIN / s: InterPro type WD40 (InterPro: IPR011046), Zone U (InterPro: IPR003613), Repetition of WD40, region (InterPro: IPR017986), Zinc finger, RING / FYVE / PHD-type (InterPro: IPR013083), WD40 Repetition (InterPro: IPR001680), WD40 / YVTN Repetition (InterPro: IPR015943), 19 mRNA Pre-Splicing Factor (InterPro: IPR013915); The BEST Arabidopsis thaliana protein match is as follows: nucleotide / protein ubiquitin-protein ligase binding (TAIR: AT2G33340.2); Has 39753 Blast strikes up to 19409 protein in 575 species: Archae – 62; Bacteria – 5219; Metazoa – 17707; Mushrooms – 7589; Plants – 3300; Virus – 0; Other eukaryotes – 5876 (source: NCBI BLink). & Nbsp AT1G04590 AT1G04590.1 TTAATGGGCCAAT FUNCTIONS IN: molecular function, unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; BEST protein correlation with Arabidopsis thaliana is as follows: pentatricopeptide repetition protein (PPR) (TAIR: AT4G18975.3); At 54 breaths at 54 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Mushrooms – 0; Plants – 52; Virus – 0; Other eukaryotes – 2 (source: NCBI BLink). & Nbsp AT1G04590.1 TTAATGGGCCAAT FUNCTIONS IN: molecular function, unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; BEST protein correlation with Arabidopsis thaliana is as follows: pentatricopeptide repetition protein (PPR) (TAIR: AT4G18975.3); At 54 breaths at 54 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Mushrooms – 0; Plants – 52; Virus – 0; Other eukaryotes – 2 (source: NCBI BLink). & Nbsp AT1G04590.2 TTAATGGGCCAAT FUNCTIONS IN: molecular function, unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; BEST protein correlation with Arabidopsis thaliana is as follows: pentatricopeptide repetition protein (PPR) (TAIR: AT4G18975.3); At 54 breaths at 54 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Mushrooms – 0; Plants – 52; Virus – 0; Other eukaryotes – 2 (source: NCBI BLink). & Nbsp AT1G04590.2 TTAATGGGCCAAT FUNCTIONS IN: molecular function, unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 stages of growth; BEST protein correlation with Arabidopsis thaliana is as follows: pentatricopeptide repetition protein (PPR) (TAIR: AT4G18975.3); At 54 breaths at 54 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Mushrooms – 0; Plants – 52; Virus – 0; Other eukaryotes – 2 (source: NCBI BLink). & Nbsp AT1G04790 AT1G04790.1 YYYYGGCCCATTAT Zinc finger family protein (C3HC4 ring fingers); FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 stages of growth; CONTAINS FIELD / s InterPro: Zinc Finger, type RING (InterPro: IPR001841), Zinc Finger, type RING / FYVE / PHD (InterPro: IPR013083); BEST protein correlation with Arabidopsis thaliana is: SDIR1 (salt-induced finger and drought); protein binding / binding ubiquitin-protein ligase / zinc ions (TAIR: AT3G55530.1); A 6374 Explosions strikes at 6356 proteins in 214 species: Archae – 0; Bacteria – 0; Metazoans – 2257; Mushrooms – 483; Plants – 2544; Viruses – 68; Other eukaryotes – 1022 (source: NCBI BLink). & Nbsp AT1G04870 AT1G04870.1 AAATGGGCCGAA Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate the basic protein of myelin in vitro. Mutants lacking PRMT10 bloom late due to defects in the autonomic pathway and exhibit high levels of FLC transcripts. & Nbsp AT1G04870.2 AAATGGGCCGAA Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate the basic protein of myelin in vitro. Mutants lacking PRMT10 bloom late due to defects in the autonomic pathway and exhibit high levels of FLC transcripts. & Nbsp AT1G05190 AT1G05190.1 ATAATGGGCCLABEL defective embryo 2394 (emb2394); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (S) InterPro: L6 ribosomal protein (InterPro: IPR000702), L6 ribosomal protein, conserved site 1 (InterPro: IPR002358); BEST protein correlation with Arabidopsis thaliana is: ribosomal L6 family protein (TAIR: AT2G18400.1); A 5749 explosions with 5749 proteins in 1580 species: Archae – 150; Bacteria – 2981; Metazoa – 10; Mushrooms – 116; Plants – 74; Virus – 0; Other eukaryotes – 2418 (source: NCBI BLink). & Nbsp AT1G05190.1 CTAATGGGCCGT defective embryo 2394 (emb2394); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (S) InterPro: L6 ribosomal protein (InterPro: IPR000702), L6 ribosomal protein, conserved site 1 (InterPro: IPR002358); BEST protein correlation with Arabidopsis thaliana is: ribosomal L6 family protein (TAIR: AT2G18400.1); A 5749 explosions with 5749 proteins in 1580 species: Archae – 150; Bacteria – 2981; Metazoa – 10; Mushrooms – 116; Plants – 74; Virus – 0; Other eukaryotes – 2418 (source: NCBI BLink). & Nbsp AT1G05190.1 TAATGGGCCGAA defective embryo 2394 (emb2394); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (S) InterPro: L6 ribosomal protein (InterPro: IPR000702), L6 ribosomal protein, conserved site 1 (InterPro: IPR002358); BEST protein correlation with Arabidopsis thaliana is: ribosomal L6 family protein (TAIR: AT2G18400.1); A 5749 explosions with 5749 proteins in 1580 species: Archae – 150; Bacteria – 2981; Metazoa – 10; Mushrooms – 116; Plants – 74; Virus – 0; Other eukaryotes – 2418 (source: NCBI BLink). & Nbsp AT1G05360 AT1G05360.1 CAATGGGCCAA unknown protein; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Unknown cell_compound EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 stages of growth; The BEST protein match with Arabidopsis thaliana is as follows: unknown protein (TAIR: AT4G14950.1); A 269 explosions with 262 proteins in 95 species: Archae – 0; Bacteria – 11; Metazoans – 157; Mushrooms – 0; Plants – 37; Virus – 0; Other eukaryotes – 64 (source: NCBI BLink). & Nbsp AT1G05850 AT1G05850.1 TAAAAGCCCAATGGGCCAT Encodes endo chitinase protein AtCTL1. Essential for stress tolerance due to heat, salt and drought. Also involved in the development of root hairs, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). The mutant is defective in acquired thermotolerance, appears semi-dwarf throughout its life cycle and has extra-lateral branches. There are two EMS alleles. The expression of AtHSP101 is not affected by mutants. & Nbsp AT1G05860 AT1G05860.1 TATGGCCCATTGGGCTTTTA unknown protein; FUNCTIONS IN: molecular function, unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 stages of growth; The BEST protein match with Arabidopsis thaliana is as follows: unknown protein (TAIR: AT2G31600.1); At 51 breaths at 50 proteins in 20 species: Archae – 0; Bacteria – 0; Metazoans – 20; Mushrooms – 2; Plants – 26; Virus – 0; Other eukaryotes – 3 (source: NCBI BLink). & Nbsp AT1G06000 AT1G06000.1 gAATGGGCCGG encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols & nbsp AT1G07070 AT1G07070.1 TATAGGCCCATTAA Ribosomal Protein L35a 60S (RPL35aA); FUNCTIONS IN: structural constituent of the ribosome; INVOLVED IN: translation, biogenesis of the ribosome; LOCATED IN: large cytosolic ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 stages of growth; CONTAINS DOMAINE (S) InterPro: L35Ae ribosomal protein (InterPro: IPR001780), L35Ae ribosomal protein, conserved site (InterPro: IPR018266); The BEST protein match with Arabidopsis thaliana is: L35a ribosomal protein (RPL35aC) 60S (TAIR: AT1G74270.1); A 541 explosions with 541 proteins in 186 species: Archae – 21; Bacteria – 0; Metazoans – 228; Mushrooms – 97; Plants – 93; Virus – 0; Other eukaryotes – 102 (source: NCBI BLink). & Nbsp AT1G07210 AT1G07210.1 YOURAATGGGCCTGG S18 family of 30S ribosomal protein; FUNCTIONS IN: structural constituent of the ribosome; IMPLIQUÉ DANS: la traduction; SITUÉ DANS: ribosome, intracellulaire; EXPRIMÉ DANS: 24 structures de plantes; EXPRIMÉ PENDANT: 15 stades de croissance; CONTIENT DOMAINE (s) InterPro: protéine ribosomale S18 (InterPro: IPR001648); A 3606 coups à 3606 protéines chez 1189 espèces: Archae – 0; Bactérie – 2426; Métazoaires – 33; Champignons – 15; Plantes – 158; Virus – 0; Autres eucaryotes – 974 (source: NCBI BLink). & Nbsp AT1G07250 AT1G07250.1 CAATGGGCCGT UDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FONCTIONS DANS: activité de la quercétine 3-O-glucosyltransférase, activité de la quercétine 7-O-glucosyltransférase, activité de la transférase, transfert de groupes glycosyle; IMPLIQUÉ DANS: processus métabolique; LOCATED IN: compose_cellulaire inconnu; EXPRIMÉ DANS: 22 structures de plantes; EXPRIMÉ PENDANT: 13 stades de croissance; CONTIENT InterPro DOMAIN / s: UDP-glucuronosyl / UDP-glucosyltransférase (InterPro: IPR002213); La correspondance de protéines BEST avec Arabidopsis thaliana est: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransférase / quercétine 3-O-glucosyltransférase / transférase, transférant des groupes glycosyle (TAIR: AT1G07260.1); A 4707 coups à 4690 protéines chez 296 espèces: Archae – 0; Bactéries – 123; Métazoa – 1851; Champignons – 11; Plantes – 2658; Virus – 37; Autres eucaryotes – 27 (source: NCBI BLink). & Nbsp AT1G07980 AT1G07980.1 TAAATGGGCCTAAA FACTOR Y NUCLEAIRE, SOUS-UNITE C10 (NF-YC10); FONCTIONS DANS: activité du facteur de transcription; IMPLIQUÉ DANS: la régulation de la transcription; SITUÉ DANS: intracellulaire, chloroplaste; EXPRIMÉ DANS: 21 structures de plantes; EXPRIMÉ PENDANT: 13 stades de croissance; CONTIENT DOMAINE / s InterPro: facteur de transcription CBF / NF-Y / histone archaé (InterPro: IPR003958), repliement d'histone (InterPro: IPR009072); A 837 frappes à 835 protéines chez 144 espèces: Archae – 0; Bactéries – 0; Métazoaires – 384; Champignons – 200; Plantes – 185; Virus – 0; Autres eucaryotes – 68 (source: NCBI BLink). & Nbsp AT1G08490 AT1G08490.1 AGGGCCCATTTA Protéine chloroplastique de type NifS pouvant catalyser la conversion de la cystéine en alanine et en soufre élémentaire (S (0)) et de la sélénocystéine en alanine et en Se élémental (Se (0)). La surexpression améliore la tolérance et l’accumulation de sélénium. & Nbsp AT1G09140 AT1G09140.1 ACAGGCCCATTAA Encode une protéine de liaison à l'ARN riche en sérine-arginine impliquée dans la régulation de l'épissage (y compris l'épissage de lui-même). Existe en 3 formes épissées alternatives qui sont exprimées de manière différentielle. & Nbsp AT1G09140.2 ACAGGCCCATTAA Encode une protéine de liaison à l'ARN riche en sérine-arginine impliquée dans la régulation de l'épissage (y compris l'épissage de lui-même). Existe en 3 formes épissées alternatives qui sont exprimées de manière différentielle. & Nbsp AT1G09150 AT1G09150.1 TTAATGGGCCTGT protéine contenant le domaine de la pseudouridine synthase et de l'archéosine transglycosylase (PUA); FONCTIONS DANS: liaison d'ARN; IMPLIQUÉ DANS: biologique_process inconnu; LOCATED IN: compose_cellulaire inconnu; EXPRIMÉ DANS: 24 structures de plantes; EXPRIMÉ PENDANT: 14 stades de croissance; CONTIENT DOMAINE (s) InterPro: type PUA (InterPro: IPR015947), PUA (InterPro: IPR002478), protéine de liaison à l'ARN associée à la machinerie de traduction, prédite (InterPro: IPR016437), domaine non caractérisé 2 (InterPro: IPR004521); La correspondance protéinique BEST avec Arabidopsis thaliana est la suivante: protéine de la famille du facteur d'initiation de la traduction eucaryote SUI1 (TAIR: AT1G71350.1); A 649 explosions à 647 protéines dans 208 espèces: Archae – 99; Bactéries – 0; Métazoaires – 263; Champignons – 102; Plantes – 42; Virus – 0; Autres eucaryotes – 143 (source: NCBI BLink). & Nbsp AT1G09660 AT1G09660.1 GTAGGCCCATTAT Protéine quaking contenant un domaine KH, putative; FONCTIONS DANS: liaison d'ARN, liaison d'acide nucléique; IMPLIQUÉ DANS: biologique_process inconnu; LOCATED IN: compose_cellulaire inconnu; EXPRIMÉ DANS: 23 structures de plantes; EXPRIMÉ PENDANT: 13 stades de croissance; CONTIENT l'homologie InterPro du DOMAIN / s: K (InterPro: IPR004087); La correspondance de protéines BEST avec Arabidopsis thaliana est la suivante: protéine contenant le domaine KH (TAIR: AT4G26480.1); A 1026 coups de souffle à 1025 protéines chez 163 espèces: Archae – 0; Bactéries – 0; Métazoaires – 712; Champignons – 103; Plantes – 149; Virus – 0; Autres eucaryotes – 62 (source: NCBI BLink). & Nbsp AT1G09660.2 GTAGGCCCATTAT Protéine quaking contenant un domaine KH, putative; FONCTIONS DANS: liaison d'ARN, liaison d'acide nucléique; IMPLIQUÉ DANS: biologique_process inconnu; LOCATED IN: compose_cellulaire inconnu; EXPRIMÉ DANS: 23 structures de plantes; EXPRIMÉ PENDANT: 13 stades de croissance; CONTIENT l'homologie InterPro du DOMAIN / s: K (InterPro: IPR004087); La correspondance de protéines BEST avec Arabidopsis thaliana est la suivante: protéine contenant le domaine KH (TAIR: AT4G26480.1); A 1026 coups de souffle à 1025 protéines chez 163 espèces: Archae – 0; Bactéries – 0; Métazoaires – 712; Champignons – 103; Plantes – 149; Virus – 0; Autres eucaryotes – 62 (source: NCBI BLink). & Nbsp AT1G09760 AT1G09760.1 CAATGGGCCGTTTA U2 petite ribonucléoprotéine nucléaire A (U2A '); FONCTIONS DANS: liaison aux protéines; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae – 0; Bacteria – 1581; Metazoa – 2979; Fungi – 220; Plants – 106; Viruses – 2; Other Eukaryotes – 591 (source: NCBI BLink).&nbsp AT1G09770 AT1G09770.1 TAAACGGCCCATTg Member of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.&nbsp AT1G09815 AT1G09815.1 CAATGGGCCGAT POLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae – 0; Bacteria – 0; Metazoa – 40; Fungi – 58; Plants – 33; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT1G09995 AT1G09995.1 UNEAATGGGCCCAGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 14; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G10050 AT1G10050.1 ACAGGCCCGGCCCATTTA Encodes a putative glycosyl hydrolase family 10 protein (xylanase).&nbsp AT1G10170 AT1G10170.1 TATAGGCCCATTGTTAGCCCATTAG Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response.&nbsp AT1G10840 AT1G10840.1 TAATGGGCCCATG Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).&nbsp AT1G10840.2 TAATGGGCCCATG Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).&nbsp AT1G11240 AT1G11240.1 TACCCTTATAATGGGCCAA unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae – 0; Bacteria – 81; Metazoa – 1026; Fungi – 315; Plants – 107; Viruses – 18; Other Eukaryotes – 905 (source: NCBI BLink).&nbsp AT1G11430 AT1G11430.1 CTAATGGGCCTAAT plastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 147; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G12310 AT1G12310.1 TAAATGGGCCUNE calmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae – 0; Bacteria – 26; Metazoa – 5264; Fungi – 3120; Plants – 2025; Viruses – 0; Other Eukaryotes – 1705 (source: NCBI BLink).&nbsp AT1G12760 AT1G12760.1 GTGGCCCATTTA protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae – 0; Bacteria – 6; Metazoa – 2304; Fungi – 503; Plants – 2742; Viruses – 19; Other Eukaryotes – 1114 (source: NCBI BLink).&nbsp AT1G12760.2 GTGGCCCATTTA protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae – 0; Bacteria – 6; Metazoa – 2304; Fungi – 503; Plants – 2742; Viruses – 19; Other Eukaryotes – 1114 (source: NCBI BLink).&nbsp AT1G13060 AT1G13060.1 ATCGGCCCATTAA Encodes 20S proteasome beta subunit PBE1 (PBE1).&nbsp AT1G14010 AT1G14010.1 TTAATGGGCCTTAA emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae – 0; Bacteria – 0; Metazoa – 587; Fungi – 291; Plants – 154; Viruses – 0; Other Eukaryotes – 117 (source: NCBI BLink).&nbsp AT1G14030 AT1G14030.1 ATAATGGGCCTTTAA ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: (ribulose-bisphosphate carboxylase)-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae – 0; Bacteria – 0; Metazoa – 242; Fungi – 218; Plants – 233; Viruses – 0; Other Eukaryotes – 145 (source: NCBI BLink).&nbsp AT1G14270 AT1G14270.1 TAAATGGGCCTTAA CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae – 48; Bacteria – 1570; Metazoa – 0; Fungi – 0; Plants – 69; Viruses – 0; Other Eukaryotes – 272 (source: NCBI BLink).&nbsp AT1G14270.2 TAAATGGGCCTTAA CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae – 48; Bacteria – 1570; Metazoa – 0; Fungi – 0; Plants – 69; Viruses – 0; Other Eukaryotes – 272 (source: NCBI BLink).&nbsp AT1G14270.3 TAAATGGGCCTTAA CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae – 48; Bacteria – 1570; Metazoa – 0; Fungi – 0; Plants – 69; Viruses – 0; Other Eukaryotes – 272 (source: NCBI BLink).&nbsp AT1G14270.4 TAAATGGGCCTTAA CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae – 48; Bacteria – 1570; Metazoa – 0; Fungi – 0; Plants – 69; Viruses – 0; Other Eukaryotes – 272 (source: NCBI BLink).&nbsp AT1G14650 AT1G14650.1 GCCCGTTAAAGGCCCATTAA SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae – 38; Bacteria – 3212; Metazoa – 15688; Fungi – 4389; Plants – 5098; Viruses – 859; Other Eukaryotes – 4089 (source: NCBI BLink).&nbsp AT1G14650.2 GCCCGTTAAAGGCCCATTAA SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae – 38; Bacteria – 3212; Metazoa – 15688; Fungi – 4389; Plants – 5098; Viruses – 859; Other Eukaryotes – 4089 (source: NCBI BLink).&nbsp AT1G14980 AT1G14980.1 TGAGGCCCATTAA Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.&nbsp AT1G15020 AT1G15020.1 TAATGGGCCTATA Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.&nbsp AT1G15020.2 TAATGGGCCTATA Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.&nbsp AT1G15215 AT1G15215.1 TTTAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G15215.2 TTTAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G15215.3 TTTAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G15270 AT1G15270.1 GGCCTTTTAATGGGCCATA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae – 0; Bacteria – 0; Metazoa – 153; Fungi – 48; Plants – 41; Viruses – 0; Other Eukaryotes – 21 (source: NCBI BLink).&nbsp AT1G15280 AT1G15280.1 TATGGCCCATTAAAAGGCC glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae – 0; Bacteria – 154; Metazoa – 1298; Fungi – 267; Plants – 178; Viruses – 66; Other Eukaryotes – 1965 (source: NCBI BLink).&nbsp AT1G15280.2 TATGGCCCATTAAAAGGCC glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae – 0; Bacteria – 154; Metazoa – 1298; Fungi – 267; Plants – 178; Viruses – 66; Other Eukaryotes – 1965 (source: NCBI BLink).&nbsp AT1G15460 AT1G15460.1 TAAATGGGCCCT Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions.&nbsp AT1G15720 AT1G15720.1 ATAATGGGCCg Arabidopsis thaliana myb family transcription factor (At1g15720)&nbsp AT1G15930 AT1G15930.1 AGCCCAATTAATAGGCCCATTTAAGCCCAAAT 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae – 164; Bacteria – 0; Metazoa – 257; Fungi – 123; Plants – 63; Viruses – 0; Other Eukaryotes – 148 (source: NCBI BLink).&nbsp AT1G15930.2 AGCCCAATTAATAGGCCCATTTAAGCCCAAAT 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae – 164; Bacteria – 0; Metazoa – 257; Fungi – 123; Plants – 63; Viruses – 0; Other Eukaryotes – 148 (source: NCBI BLink).&nbsp AT1G16030 AT1G16030.1 ATATGGGCTTTAATAGGCCCATTTA heat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae – 107; Bacteria – 9686; Metazoa – 3084; Fungi – 1225; Plants – 724; Viruses – 242; Other Eukaryotes – 9641 (source: NCBI BLink).&nbsp AT1G16040 AT1G16040.1 TAAATGGGCCTATTAAAGCCCATAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae – 0; Bacteria – 0; Metazoa – 96; Fungi – 80; Plants – 30; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT1G16870 AT1G16870.1 TTAATGGGCCTAAC mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae – 0; Bacteria – 0; Metazoa – 92; Fungi – 30; Plants – 19; Viruses – 0; Other Eukaryotes – 43 (source: NCBI BLink).&nbsp AT1G17070 AT1G17070.1 TAAATGGGCCTTTA D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae – 2; Bacteria – 0; Metazoa – 613; Fungi – 98; Plants – 108; Viruses – 1; Other Eukaryotes – 157 (source: NCBI BLink).&nbsp AT1G17690 AT1G17690.1 CAAGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae – 70; Bacteria – 4843; Metazoa – 8327; Fungi – 2833; Plants – 863; Viruses – 487; Other Eukaryotes – 7064 (source: NCBI BLink).&nbsp AT1G17760 AT1G17760.1 TTAATGGGCCAA Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.&nbsp AT1G18070 AT1G18070.1 CTAAGGCCCATTAGTTGGGCTTT EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae – 559; Bacteria – 19088; Metazoa – 14337; Fungi – 8307; Plants – 1150; Viruses – 0; Other Eukaryotes – 10830 (source: NCBI BLink).&nbsp AT1G18070.2 CTAAGGCCCATTAGTTGGGCTTT EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae – 559; Bacteria – 19088; Metazoa – 14337; Fungi – 8307; Plants – 1150; Viruses – 0; Other Eukaryotes – 10830 (source: NCBI BLink).&nbsp AT1G18480 AT1G18480.1 TTAATGGGCCTAC calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae – 12; Bacteria – 139; Metazoa – 0; Fungi – 17; Plants – 53; Viruses – 3; Other Eukaryotes – 209 (source: NCBI BLink).&nbsp AT1G18540 AT1G18540.1 ATAAGGGCCCATTAG 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae – 13; Bacteria – 0; Metazoa – 257; Fungi – 97; Plants – 77; Viruses – 0; Other Eukaryotes – 105 (source: NCBI BLink).&nbsp AT1G20340 AT1G20340.1 CAAAGCCCATTAAGGCCCATTT recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.&nbsp AT1G20350 AT1G20350.1 UNEAATGGGCCTTAATGGGCTTTG mitochondrial inner membrane translocase&nbsp AT1G20510 AT1G20510.1 TAAAGGCCCATTAT OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae – 597; Bacteria – 29739; Metazoa – 3091; Fungi – 3124; Plants – 1312; Viruses – 1; Other Eukaryotes – 17922 (source: NCBI BLink).&nbsp AT1G20510.2 TAAAGGCCCATTAT OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae – 597; Bacteria – 29739; Metazoa – 3091; Fungi – 3124; Plants – 1312; Viruses – 1; Other Eukaryotes – 17922 (source: NCBI BLink).&nbsp AT1G20540 AT1G20540.1 GTTAGGCCCATTAA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae – 0; Bacteria – 624; Metazoa – 3227; Fungi – 1427; Plants – 781; Viruses – 0; Other Eukaryotes – 700 (source: NCBI BLink).&nbsp AT1G20620 AT1G20620.1 ATGGCCCATTT Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.&nbsp AT1G20620.2 ATGGCCCATTT Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.&nbsp AT1G20620.5 ATGGCCCATTT Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.&nbsp AT1G20760 AT1G20760.1 ATTAGGCCTATAAAGGCCCATTTA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae – 12; Bacteria – 3271; Metazoa – 3323; Fungi – 1334; Plants – 262; Viruses – 16; Other Eukaryotes – 2474 (source: NCBI BLink).&nbsp AT1G20770 AT1G20770.1 TTAATGGGCCTTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae – 0; Bacteria – 0; Metazoa – 19; Fungi – 2; Plants – 16; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G20780 AT1G20780.1 TAAAGGCCCATTAA Encodes a protein containing a U-box and an ARM domain.&nbsp AT1G21100 AT1G21100.1 AGAGGCCCATTAG O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae – 0; Bacteria – 600; Metazoa – 84; Fungi – 432; Plants – 916; Viruses – 0; Other Eukaryotes – 94 (source: NCBI BLink).&nbsp AT1G21280 AT1G21280.1 CAAGGCCCATTAAGCCCAACT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae – 0; Bacteria – 0; Metazoa – 4; Fungi – 0; Plants – 590; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G21790 AT1G21790.1 UNEAATGGGCCGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae – 0; Bacteria – 0; Metazoa – 84; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT1G22520 AT1G22520.1 ATAAGGCCCATTAATCGGCCCAATAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).&nbsp AT1G22520.2 ATAAGGCCCATTAATCGGCCCAATAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).&nbsp AT1G22840 AT1G22840.1 CCCATTAAGGGCCCATTAAG Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.&nbsp AT1G22840.2 CCCATTAAGGGCCCATTAAG Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.&nbsp AT1G23100 AT1G23100.1 gAATGGGCCTGGGCCACGTA 10 kDa chaperonin, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Chaperonin Cpn10, conserved site (InterPro:IPR018369), Chaperonin Cpn10 (InterPro:IPR001476); BEST Arabidopsis thaliana protein match is: CPN10 (CHAPERONIN 10); chaperone binding (TAIR:AT1G14980.1); Has 5807 Blast hits to 5744 proteins in 1499 species: Archae – 0; Bacteria – 3188; Metazoa – 245; Fungi – 75; Plants – 201; Viruses – 2; Other Eukaryotes – 2096 (source: NCBI BLink).&nbsp AT1G23205 AT1G23205.1 TCAGGCCCAGATCGGCCCATTAA invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 417; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G23280 AT1G23280.1 TGAGGCCCATTAT MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae – 5; Bacteria – 214; Metazoa – 2654; Fungi – 567; Plants – 207; Viruses – 131; Other Eukaryotes – 1685 (source: NCBI BLink).&nbsp AT1G23290 AT1G23290.1 ATAATGGGCCTCA Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.&nbsp AT1G23740 AT1G23740.1 TTTAGGCCCATTAA oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae – 321; Bacteria – 14032; Metazoa – 1331; Fungi – 2499; Plants – 781; Viruses – 3; Other Eukaryotes – 6768 (source: NCBI BLink).&nbsp AT1G23750 AT1G23750.1 TTAATGGGCCTAAA DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae – 26; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 96; Viruses – 0; Other Eukaryotes – 14 (source: NCBI BLink).&nbsp AT1G23890 AT1G23890.1 TAAATGGGCCCTACTTGGGCCGTTTT NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae – 109; Bacteria – 916; Metazoa – 129; Fungi – 0; Plants – 86; Viruses – 0; Other Eukaryotes – 681 (source: NCBI BLink).&nbsp AT1G23890.2 TAAATGGGCCCTACTTGGGCCGTTTT NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae – 109; Bacteria – 916; Metazoa – 129; Fungi – 0; Plants – 86; Viruses – 0; Other Eukaryotes – 681 (source: NCBI BLink).&nbsp AT1G23900 AT1G23900.1 AAAACGGCCCAAGTAGGGCCCATTTA Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane&nbsp AT1G23900.2 AAAACGGCCCAAGTAGGGCCCATTTA Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane&nbsp AT1G24170 AT1G24170.1 CTTAATGGGCCAA Encodes a protein with putative galacturonosyltransferase activity.&nbsp AT1G27070 AT1G27070.1 UNEAATGGGCCTATA 5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae – 1; Bacteria – 66; Metazoa – 210; Fungi – 126; Plants – 98; Viruses – 0; Other Eukaryotes – 72 (source: NCBI BLink).&nbsp AT1G27310 AT1G27310.1 ATAAGGCCCATTTA Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.&nbsp AT1G27385 AT1G27385.1 UNEAATGGGCCTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).&nbsp AT1G27385.2 UNEAATGGGCCTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).&nbsp AT1G27385.3 UNEAATGGGCCTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).&nbsp AT1G27385.4 UNEAATGGGCCTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).&nbsp AT1G27435 AT1G27435.1 UNEAATGGGCCTAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 8; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G28120 AT1G28120.1 TTTAGGCCCATTT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae – 0; Bacteria – 0; Metazoa – 150; Fungi – 50; Plants – 47; Viruses – 0; Other Eukaryotes – 48 (source: NCBI BLink).&nbsp AT1G30380 AT1G30380.1 TAAATGGGCCTG Encodes subunit K of photosystem I reaction center.&nbsp AT1G30680 AT1G30680.1 UNEAATGGGCCAGGCCCAAT toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae – 0; Bacteria – 107; Metazoa – 40; Fungi – 0; Plants – 35; Viruses – 109; Other Eukaryotes – 584 (source: NCBI BLink).&nbsp AT1G30680.1 TTAATGGGCCTTTT toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae – 0; Bacteria – 107; Metazoa – 40; Fungi – 0; Plants – 35; Viruses – 109; Other Eukaryotes – 584 (source: NCBI BLink).&nbsp AT1G30845 AT1G30845.1 TTAATGGGCCATAAGCCCATA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae – 0; Bacteria – 0; Metazoa – 28; Fungi – 19; Plants – 11; Viruses – 0; Other Eukaryotes – 13 (source: NCBI BLink).&nbsp AT1G31420 AT1G31420.1 TAATGGGCCTTAAAAATGGGCCCAATG Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.&nbsp AT1G32490 AT1G32490.1 TTGGCCCATTTA Encodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing.&nbsp AT1G32580 AT1G32580.1 ATTGGCCCATTTA plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 151; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G32580.1 TTCGGCCCATTAA plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 151; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G32990 AT1G32990.1 TTTAGGCCCATTAAGCCCATAA mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11&nbsp AT1G33330 AT1G33330.1 TAAATGGGCCAAGCCCA peptide chain release factor, putative; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); BEST Arabidopsis thaliana protein match is: peptide chain release factor, putative (TAIR:AT1G56350.1); Has 9739 Blast hits to 9739 proteins in 1553 species: Archae – 0; Bacteria – 5377; Metazoa – 210; Fungi – 152; Plants – 96; Viruses – 10; Other Eukaryotes – 3894 (source: NCBI BLink).&nbsp AT1G33410 AT1G33410.1 TAAATGGGCCGTA suppressor of auxin resistance1 (SAR1); INVOLVED IN: response to auxin stimulus, mRNA export from nucleus, developmental process; LOCATED IN: nuclear membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 129 proteins in 58 species: Archae – 0; Bacteria – 0; Metazoa – 84; Fungi – 24; Plants – 26; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT1G33980 AT1G33980.1 TTAAGGCCCATTAGAGGCCCATATA Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)&nbsp AT1G33980.2 TTAAGGCCCATTAGAGGCCCATATA Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)&nbsp AT1G34190 AT1G34190.1 ATAATGGGCCTGT Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae – 0; Bacteria – 2; Metazoa – 0; Fungi – 0; Plants – 1564; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT1G34190.1 TTAATGGGCCTGA Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae – 0; Bacteria – 2; Metazoa – 0; Fungi – 0; Plants – 1564; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT1G44750 AT1G44750.1 ATTGGCCCATTAA Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.&nbsp AT1G47720 AT1G47720.1 ATAATGGGCCTAG Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination.&nbsp AT1G47720.1 gAATGGGCCTAAA Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination.&nbsp AT1G48320 AT1G48320.1 CTAATGGGCCTTTA thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae – 0; Bacteria – 1172; Metazoa – 3; Fungi – 0; Plants – 89; Viruses – 0; Other Eukaryotes – 375 (source: NCBI BLink).&nbsp AT1G48420 AT1G48420.1 gAATGGGCCGAGGCCCATAA Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity.&nbsp AT1G48900 AT1G48900.1 GTAAGGCCCATTAA signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae – 312; Bacteria – 5666; Metazoa – 264; Fungi – 192; Plants – 147; Viruses – 0; Other Eukaryotes – 5442 (source: NCBI BLink).&nbsp AT1G48900.2 GTAAGGCCCATTAA signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae – 312; Bacteria – 5666; Metazoa – 264; Fungi – 192; Plants – 147; Viruses – 0; Other Eukaryotes – 5442 (source: NCBI BLink).&nbsp AT1G49140 AT1G49140.1 TGAGGCCCATTAA NADH-ubiquinone oxidoreductase-related; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT3G18410.2); Has 96 Blast hits to 96 proteins in 44 species: Archae – 0; Bacteria – 0; Metazoa – 6; Fungi – 54; Plants – 36; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G50170 AT1G50170.1 ATGGCCCATTAA encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis&nbsp AT1G51650 AT1G51650.1 ATAAGGCCCATTg ATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 112; Fungi – 3; Plants – 40; Viruses – 0; Other Eukaryotes – 15 (source: NCBI BLink).&nbsp AT1G51650.1 CTTAATGGGCCGTTAAA ATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 112; Fungi – 3; Plants – 40; Viruses – 0; Other Eukaryotes – 15 (source: NCBI BLink).&nbsp AT1G51965 AT1G51965.1 GTAAGGCCCATTAA pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae – 5; Bacteria – 14; Metazoa – 565; Fungi – 542; Plants – 18830; Viruses – 0; Other Eukaryotes – 1235 (source: NCBI BLink).&nbsp AT1G51965.1 TTAAGGCCCATTTA pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae – 5; Bacteria – 14; Metazoa – 565; Fungi – 542; Plants – 18830; Viruses – 0; Other Eukaryotes – 1235 (source: NCBI BLink).&nbsp AT1G52670 AT1G52670.1 TAATGGGCCCTA biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae – 0; Bacteria – 1300; Metazoa – 2; Fungi – 0; Plants – 75; Viruses – 0; Other Eukaryotes – 568 (source: NCBI BLink).&nbsp AT1G53140 AT1G53140.1 TGAGGCCCAATACGGCCCATTAA Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis.&nbsp AT1G54100 AT1G54100.1 TTAATGGGCCTGGCCCATA Aldehyde dehydrogenase&nbsp AT1G54100.2 TTAATGGGCCTGGCCCATA Aldehyde dehydrogenase&nbsp AT1G54140 AT1G54140.1 TTAATGGGCCTAT putative TATA binding protein associated factor 21kDa&nbsp AT1G54150 AT1G54150.1 ATAGGCCCATTAA zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae – 0; Bacteria – 0; Metazoa – 1041; Fungi – 23; Plants – 178; Viruses – 133; Other Eukaryotes – 197 (source: NCBI BLink).&nbsp AT1G54310 AT1G54310.1 UNEAATGGGCCCAATAA RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae – 69; Bacteria – 3053; Metazoa – 33; Fungi – 6; Plants – 28; Viruses – 0; Other Eukaryotes – 462 (source: NCBI BLink).&nbsp AT1G54310.1 GTGGCCCATTAG RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae – 69; Bacteria – 3053; Metazoa – 33; Fungi – 6; Plants – 28; Viruses – 0; Other Eukaryotes – 462 (source: NCBI BLink).&nbsp AT1G54360 AT1G54360.1 GATGGGCCCATTT Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.&nbsp AT1G54360.2 GATGGGCCCATTT Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.&nbsp AT1G54360.3 GATGGGCCCATTT Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.&nbsp AT1G56070 AT1G56070.1 ATTGGCCCATTAAGGCCCATTAAG encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.&nbsp AT1G56110 AT1G56110.1 CCGTTAAATGGGCCTGGCCCATTg NOP56-like protein&nbsp AT1G56460 AT1G56460.1 TAATGGGCCGAT PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT2G47350.1); Has 6344 Blast hits to 4558 proteins in 417 species: Archae – 6; Bacteria – 427; Metazoa – 2467; Fungi – 794; Plants – 231; Viruses – 26; Other Eukaryotes – 2393 (source: NCBI BLink).&nbsp AT1G57540 AT1G57540.1 DCGGCCCATTAAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 15; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G57540.2 DCGGCCCATTAAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 15; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G57540.3 DCGGCCCATTAAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 15; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G57660 AT1G57660.1 TATGGCCCAATCAGGCCCATTTA 60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae – 143; Bacteria – 0; Metazoa – 615; Fungi – 122; Plants – 82; Viruses – 0; Other Eukaryotes – 184 (source: NCBI BLink).&nbsp AT1G58025 AT1G58025.1 GTGGCCCATTGTAAGCCCAAAA DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Bromodomain, conserved site (InterPro:IPR018359), Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE6 (GENERAL TRANSCRIPTION FACTOR GROUP E6); DNA binding / H3/H4 histone acetyltransferase (TAIR:AT3G52280.1); Has 1681 Blast hits to 1341 proteins in 127 species: Archae – 0; Bacteria – 31; Metazoa – 1070; Fungi – 94; Plants – 24; Viruses – 13; Other Eukaryotes – 449 (source: NCBI BLink).&nbsp AT1G58200 AT1G58200.1 gAATGGGCCTAACGATGGGCCCATTT A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.&nbsp AT1G58200.2 gAATGGGCCTAACGATGGGCCCATTT A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.&nbsp AT1G58210 AT1G58210.1 UNEAATGGGCCCATCGTTAGGCCCATTC EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae – 370; Bacteria – 1847; Metazoa – 13466; Fungi – 2008; Plants – 1045; Viruses – 70; Other Eukaryotes – 5818 (source: NCBI BLink).&nbsp AT1G60600 AT1G60600.1 TAATGGGCCTTAAAGGCCCAC Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.&nbsp AT1G60600.2 TAATGGGCCTTAAAGGCCCAC Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.&nbsp AT1G60780 AT1G60780.1 CAATGGGCCTTT HAPLESS 13 (HAP13); FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT1G10730.1); Has 1643 Blast hits to 1593 proteins in 209 species: Archae – 0; Bacteria – 0; Metazoa – 929; Fungi – 318; Plants – 104; Viruses – 0; Other Eukaryotes – 292 (source: NCBI BLink).&nbsp AT1G61570 AT1G61570.1 ACAGGCCCATTAA Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space.&nbsp AT1G63880 AT1G63880.1 AGGGCCCATTg Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans.&nbsp AT1G63900 AT1G63900.1 GTAGGCCCATTg zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae – 0; Bacteria – 8; Metazoa – 1654; Fungi – 30; Plants – 409; Viruses – 201; Other Eukaryotes – 363 (source: NCBI BLink).&nbsp AT1G64490 AT1G64490.1 TCGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42060.1); Has 43 Blast hits to 42 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 2; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT1G64490.1 TCGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42060.1); Has 43 Blast hits to 42 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 2; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT1G64628 AT1G64628.1 AAGGCCCATTTA Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1&nbsp AT1G64630 AT1G64630.1 AAGGCCCATTTA WITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae – 28; Bacteria – 5972; Metazoa – 32664; Fungi – 6701; Plants – 16849; Viruses – 382; Other Eukaryotes – 14589 (source: NCBI BLink).&nbsp AT1G64850 AT1G64850.1 TAAATGGGCCGTT calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 40; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G64850.1 TTAAGGCCCATTTGAGCCCA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 40; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G65370 AT1G65370.1 TTTAGGCCCATTC meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65150.2); Has 227 Blast hits to 224 proteins in 14 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 220; Viruses – 0; Other Eukaryotes – 7 (source: NCBI BLink).&nbsp AT1G66500 AT1G66500.1 ACAGGCCCATTAA zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae – 0; Bacteria – 0; Metazoa – 91; Fungi – 85; Plants – 35; Viruses – 0; Other Eukaryotes – 64 (source: NCBI BLink).&nbsp AT1G66530 AT1G66530.1 ATAATGGGCCTCT arginyl-tRNA synthetase, putative / arginine–tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae – 156; Bacteria – 2983; Metazoa – 242; Fungi – 116; Plants – 35; Viruses – 3; Other Eukaryotes – 3003 (source: NCBI BLink).&nbsp AT1G67250 AT1G67250.1 TTAATGGGCCTTAG proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae – 0; Bacteria – 0; Metazoa – 90; Fungi – 2; Plants – 63; Viruses – 0; Other Eukaryotes – 15 (source: NCBI BLink).&nbsp AT1G67320 AT1G67320.1 ATATGGGCCCATTAATAGGCCCAACA DNA primase, large subunit family; FUNCTIONS IN: DNA primase activity; INVOLVED IN: DNA replication, synthesis of RNA primer; LOCATED IN: alpha DNA polymerase:primase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA primase, large subunit, eukaryotic (InterPro:IPR016558), DNA primase, large subunit, eukaryotic/archaeal (InterPro:IPR007238); Has 329 Blast hits to 325 proteins in 153 species: Archae – 6; Bacteria – 0; Metazoa – 133; Fungi – 93; Plants – 26; Viruses – 0; Other Eukaryotes – 71 (source: NCBI BLink).&nbsp AT1G67430 AT1G67430.1 CAAGGCCCATTTA 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae – 235; Bacteria – 361; Metazoa – 438; Fungi – 108; Plants – 104; Viruses – 0; Other Eukaryotes – 398 (source: NCBI BLink).&nbsp AT1G68100 AT1G68100.1 CAATGGGCCAA member of IAA-alanine resistance protein 1&nbsp AT1G68830 AT1G68830.1 TTAATGGGCCTAAA STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation&nbsp AT1G69740 AT1G69740.1 ACAGGCCCATTAA Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.&nbsp AT1G69740.2 ACAGGCCCATTAA Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.&nbsp AT1G71260 AT1G71260.1 TAAAGGCCCATTGGGCCGTTAAA Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus.&nbsp AT1G71270 AT1G71270.1 TTTAACGGCCCAATGGGCCTTTA Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.&nbsp AT1G71500 AT1G71500.1 CAAGGCCCATTg Rieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske (2Fe-2S) iron-sulphur domain (InterPro:IPR017941), Rieske (2Fe-2S) region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae – 0; Bacteria – 101; Metazoa – 0; Fungi – 0; Plants – 72; Viruses – 0; Other Eukaryotes – 34 (source: NCBI BLink).&nbsp AT1G72020 AT1G72020.1 TAAATGGGCCTGGCCCAAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 34; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT1G72090 AT1G72090.1 TCGACCCGACCCAGGCCCATTUNE radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae – 269; Bacteria – 4639; Metazoa – 269; Fungi – 0; Plants – 54; Viruses – 0; Other Eukaryotes – 5110 (source: NCBI BLink).&nbsp AT1G73230 AT1G73230.1 UNEAATGGGCCUNE nascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae – 0; Bacteria – 0; Metazoa – 331; Fungi – 126; Plants – 89; Viruses – 0; Other Eukaryotes – 72 (source: NCBI BLink).&nbsp AT1G73840 AT1G73840.1 TAAATGGGCCGG Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors.&nbsp AT1G74260 AT1G74260.1 ATCGGCCCTTAGGCCCATTAG Encodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development.&nbsp AT1G74970 AT1G74970.1 TTAATGGGCTCTAATGGGCCGAT ribosomal protein S9, nuclear encoded component of the chloroplast ribosome&nbsp AT1G75330 AT1G75330.1 UNEAATGGGCCTAG ORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae – 346; Bacteria – 6031; Metazoa – 180; Fungi – 195; Plants – 66; Viruses – 6; Other Eukaryotes – 4513 (source: NCBI BLink).&nbsp AT1G75510 AT1G75510.1 AACGGCCCATTAA transcription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae – 0; Bacteria – 0; Metazoa – 104; Fungi – 84; Plants – 32; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT1G76020 AT1G76020.1 TATGGCCCATTUNE INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae – 0; Bacteria – 51; Metazoa – 12; Fungi – 4; Plants – 28; Viruses – 0; Other Eukaryotes – 23 (source: NCBI BLink).&nbsp AT1G76030 AT1G76030.1 TAATGGGCCATA Encodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus.&nbsp AT1G76050 AT1G76050.1 TATGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76050.1 TATGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76050.1 TTAAGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76050.2 TATGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76050.2 TATGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76050.2 TTAAGGCCCATTTA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae – 12; Bacteria – 7400; Metazoa – 221; Fungi – 125; Plants – 119; Viruses – 0; Other Eukaryotes – 4681 (source: NCBI BLink).&nbsp AT1G76200 AT1G76200.1 UNEAATGGGCCTTTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 29; Plants – 27; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT1G76300 AT1G76300.1 CTAATGGGCCCAATAA snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 227; Plants – 127; Viruses – 0; Other Eukaryotes – 152 (source: NCBI BLink).&nbsp AT1G76300.1 CTAATGGGCCGAT snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 227; Plants – 127; Viruses – 0; Other Eukaryotes – 152 (source: NCBI BLink).&nbsp AT1G76730 AT1G76730.1 AAAAGGCCCATTTA 5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae – 50; Bacteria – 73; Metazoa – 104; Fungi – 6; Plants – 17; Viruses – 0; Other Eukaryotes – 20 (source: NCBI BLink).&nbsp AT1G76740 AT1G76740.1 TAAATGGGCCTTTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae – 9; Bacteria – 251; Metazoa – 1340; Fungi – 208; Plants – 114; Viruses – 8; Other Eukaryotes – 1206 (source: NCBI BLink).&nbsp AT1G76940 AT1G76940.1 TAAATGGGCCTTAA RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae – 0; Bacteria – 0; Metazoa – 247; Fungi – 119; Plants – 55; Viruses – 0; Other Eukaryotes – 29 (source: NCBI BLink).&nbsp AT1G77030 AT1G77030.1 TTAATGGGCCTTAATGG ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae – 31; Bacteria – 19714; Metazoa – 12532; Fungi – 2798; Plants – 5760; Viruses – 615; Other Eukaryotes – 5007 (source: NCBI BLink).&nbsp AT1G77060 AT1G77060.1 TAAAGGCCCATTT mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G21440.1); Has 6429 Blast hits to 6429 proteins in 855 species: Archae – 72; Bacteria – 2891; Metazoa – 29; Fungi – 318; Plants – 109; Viruses – 0; Other Eukaryotes – 3010 (source: NCBI BLink).&nbsp AT1G77270 AT1G77270.1 TTCGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07730.1); Has 365 Blast hits to 331 proteins in 76 species: Archae – 0; Bacteria – 25; Metazoa – 174; Fungi – 10; Plants – 59; Viruses – 0; Other Eukaryotes – 97 (source: NCBI BLink).&nbsp AT1G77540 AT1G77540.1 AATAGGCCCATTAATAGGCCC Encodes a H3/H4 histone acetyltransferase. Belongs to the GNAT family, whose many members are involved in histone acetylation and chromatin remodeling, and are important for the regulation of cell growth and development.&nbsp AT1G77710 AT1G77710.1 UNEAATGGGCCTAAAATGGGCCTGA INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-like, Ufm1 (InterPro:IPR005375); Has 170 Blast hits to 170 proteins in 79 species: Archae – 0; Bacteria – 0; Metazoa – 105; Fungi – 0; Plants – 27; Viruses – 0; Other Eukaryotes – 38 (source: NCBI BLink).&nbsp AT1G78190 AT1G78190.1 AAAAGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae – 0; Bacteria – 0; Metazoa – 117; Fungi – 81; Plants – 34; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT1G79590 AT1G79590.1 TAAATGGGCCTTAA Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.&nbsp AT1G79590.2 TAAATGGGCCTTAA Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.&nbsp AT1G79710 AT1G79710.1 CAATGGGCCCAAAT integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae – 4; Bacteria – 113; Metazoa – 0; Fungi – 0; Plants – 141; Viruses – 0; Other Eukaryotes – 436 (source: NCBI BLink).&nbsp AT1G79710.1 CTAATGGGCCACAAAAAGCCCATCT integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae – 4; Bacteria – 113; Metazoa – 0; Fungi – 0; Plants – 141; Viruses – 0; Other Eukaryotes – 436 (source: NCBI BLink).&nbsp AT1G80770 AT1G80770.1 AGAGGCCCATTAG pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae – 192; Bacteria – 3675; Metazoa – 331; Fungi – 218; Plants – 119; Viruses – 0; Other Eukaryotes – 2219 (source: NCBI BLink).&nbsp AT2G01110 AT2G01110.1 TAATGGGCCTTAT mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein.&nbsp AT2G01120 AT2G01120.1 ATAAGGCCCATTUNE Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b.&nbsp AT2G01140 AT2G01140.1 DCGGCCCATTC fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: response to oxidative stress, response to cadmium ion, pentose-phosphate shunt; LOCATED IN: mitochondrion, chloroplast, plastoglobule; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4200 Blast hits to 4196 proteins in 676 species: Archae – 0; Bacteria – 431; Metazoa – 1018; Fungi – 2; Plants – 339; Viruses – 0; Other Eukaryotes – 2410 (source: NCBI BLink).&nbsp AT2G01400 AT2G01400.1 CTAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 13; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G01470 AT2G01470.1 TAATGGGCCTTAA Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.&nbsp AT2G01650 AT2G01650.1 TTGGCCCAAAAGGCCCATTAA encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.&nbsp AT2G01720 AT2G01720.1 ACGGCCCATTAA ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae – 0; Bacteria – 0; Metazoa – 125; Fungi – 87; Plants – 31; Viruses – 0; Other Eukaryotes – 42 (source: NCBI BLink).&nbsp AT2G01870 AT2G01870.1 UNEAATGGGCCCAATT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G02500 AT2G02500.1 TTAATGGGCCTGATGGGCTTAT Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).&nbsp AT2G02510 AT2G02510.1 ATAAGCCCATCAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 4; Plants – 34; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G02880 AT2G02880.1 TTAAGGCCCATTTA mucin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62270.1); Has 72 Blast hits to 72 proteins in 17 species: Archae – 0; Bacteria – 2; Metazoa – 3; Fungi – 6; Plants – 38; Viruses – 0; Other Eukaryotes – 23 (source: NCBI BLink).&nbsp AT2G03270 AT2G03270.1 UNEAATGGGCCTAAA DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae – 141; Bacteria – 1267; Metazoa – 1124; Fungi – 651; Plants – 305; Viruses – 8; Other Eukaryotes – 902 (source: NCBI BLink).&nbsp AT2G04030 AT2G04030.1 TATAGGCCCATTAT Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.&nbsp AT2G04030.2 TATAGGCCCATTAT Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.&nbsp AT2G04410 AT2G04410.1 TAACGGGCCCATTAAGGCCCAAAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 139; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT2G05920 AT2G05920.1 UNEAATGGGCCTGA subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae – 130; Bacteria – 2232; Metazoa – 135; Fungi – 512; Plants – 867; Viruses – 0; Other Eukaryotes – 494 (source: NCBI BLink).&nbsp AT2G11890 AT2G11890.1 UNEAATGGGCCAA adenylate cyclase&nbsp AT2G11890.2 UNEAATGGGCCAA adenylate cyclase&nbsp AT2G15290 AT2G15290.1 CAATGGGCCGTT Encodes a protein located in the chloroplast inner envelope. The study of mutant defective in the gene product suggests that the protein is involved in the translocation of protein across the envelope membrane into the chloroplast stroma.&nbsp AT2G17870 AT2G17870.1 AATAGGCCCATTT cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae – 36; Bacteria – 18684; Metazoa – 10644; Fungi – 2506; Plants – 4908; Viruses – 6728; Other Eukaryotes – 9648 (source: NCBI BLink).&nbsp AT2G17975 AT2G17975.1 TTAATGGGCCTAATGGGCCTAG zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae – 0; Bacteria – 0; Metazoa – 304; Fungi – 62; Plants – 313; Viruses – 0; Other Eukaryotes – 214 (source: NCBI BLink).&nbsp AT2G17980 AT2G17980.1 CTAGGCCCATTUNEGGCCCATTAA member of SLY1 Gene Family&nbsp AT2G18020 AT2G18020.1 CTTAGGCCCATTAG embryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae – 236; Bacteria – 3117; Metazoa – 334; Fungi – 188; Plants – 928; Viruses – 0; Other Eukaryotes – 2616 (source: NCBI BLink).&nbsp AT2G18510 AT2G18510.1 CTTAATGGGCTTATAGGCCCATTAG embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae – 48; Bacteria – 4095; Metazoa – 27429; Fungi – 7959; Plants – 8932; Viruses – 890; Other Eukaryotes – 6831 (source: NCBI BLink).&nbsp AT2G18710 AT2G18710.1 TATTGGGCCTAAAAGGCCTGGCCCATTAG SecY Homolog 1 (SCY1); FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: EMB2289 (EMBRYO DEFECTIVE 2289); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT2G31530.1); Has 6517 Blast hits to 6501 proteins in 1505 species: Archae – 48; Bacteria – 2805; Metazoa – 25; Fungi – 2; Plants – 53; Viruses – 0; Other Eukaryotes – 3584 (source: NCBI BLink).&nbsp AT2G19750 AT2G19750.1 TACGGCCCATTAA 40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae – 2; Bacteria – 0; Metazoa – 223; Fungi – 90; Plants – 56; Viruses – 1; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT2G19750.1 TTAAGGCCCATTTA 40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae – 2; Bacteria – 0; Metazoa – 223; Fungi – 90; Plants – 56; Viruses – 1; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT2G20210 AT2G20210.1 CGGCCCATTAT leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, ribonuclease inhibitor subtype (InterPro:IPR003590); Has 1691 Blast hits to 1352 proteins in 107 species: Archae – 0; Bacteria – 100; Metazoa – 1035; Fungi – 8; Plants – 127; Viruses – 0; Other Eukaryotes – 421 (source: NCBI BLink).&nbsp AT2G20330 AT2G20330.1 TAAATGGGCCTTTA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 23940 Blast hits to 14550 proteins in 496 species: Archae – 38; Bacteria – 4162; Metazoa – 9990; Fungi – 4392; Plants – 2081; Viruses – 20; Other Eukaryotes – 3257 (source: NCBI BLink).&nbsp AT2G20360 AT2G20360.1 CAAGGCCCAGGCCCATTT binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae – 40; Bacteria – 1834; Metazoa – 120; Fungi – 89; Plants – 50; Viruses – 0; Other Eukaryotes – 1690 (source: NCBI BLink).&nbsp AT2G20450 AT2G20450.1 TTAATGGGCCTTTAA 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae – 58; Bacteria – 0; Metazoa – 210; Fungi – 93; Plants – 65; Viruses – 0; Other Eukaryotes – 105 (source: NCBI BLink).&nbsp AT2G20480 AT2G20480.1 CAATGGGCCTAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G20490 AT2G20490.1 GTAGGCCCATTg NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 74; Plants – 27; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT2G20490.2 GTAGGCCCATTg NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 74; Plants – 27; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT2G20530 AT2G20530.1 CTAATGGGCCTGA PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae – 119; Bacteria – 948; Metazoa – 392; Fungi – 189; Plants – 171; Viruses – 10; Other Eukaryotes – 571 (source: NCBI BLink).&nbsp AT2G20530.2 CTAATGGGCCTGA PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae – 119; Bacteria – 948; Metazoa – 392; Fungi – 189; Plants – 171; Viruses – 10; Other Eukaryotes – 571 (source: NCBI BLink).&nbsp AT2G20860 AT2G20860.1 TTAATGGGCCTAC LIP1,Lipoic acid synthase,&nbsp AT2G20890 AT2G20890.1 TAAATGGGCCTAAT Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.&nbsp AT2G21060 AT2G21060.1 TGGCCCATTT glycine-rich protein (AtGRP2b)&nbsp AT2G21190 AT2G21190.1 CCCGGCCCATTTA ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT4G38790.1); Has 626 Blast hits to 626 proteins in 164 species: Archae – 0; Bacteria – 0; Metazoa – 264; Fungi – 114; Plants – 120; Viruses – 0; Other Eukaryotes – 128 (source: NCBI BLink).&nbsp AT2G21280 AT2G21280.1 TAAATGGGCCTTAA A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system.&nbsp AT2G21290 AT2G21290.1 TTAAGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G23090 AT2G23090.1 AAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 33; Plants – 46; Viruses – 0; Other Eukaryotes – 25 (source: NCBI BLink).&nbsp AT2G23390 AT2G23390.1 TTAATGGGCCTAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae – 0; Bacteria – 707; Metazoa – 0; Fungi – 0; Plants – 15; Viruses – 0; Other Eukaryotes – 1084 (source: NCBI BLink).&nbsp AT2G24395 AT2G24395.1 TTAATGGGCCTT chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 1; Fungi – 0; Plants – 14; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT2G24490 AT2G24490.1 CTTAGGCCCATTT Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.&nbsp AT2G24490.2 CTTAGGCCCATTT Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.&nbsp AT2G24590 AT2G24590.1 CGGCCCATTTTAAGCCCAAAT splicing factor, putative; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; LOCATED IN: nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: SRZ-22; protein binding (TAIR:AT4G31580.2); Has 9855 Blast hits to 8604 proteins in 578 species: Archae – 6; Bacteria – 593; Metazoa – 5438; Fungi – 1074; Plants – 1815; Viruses – 79; Other Eukaryotes – 850 (source: NCBI BLink).&nbsp AT2G24765 AT2G24765.1 CAATGGGCCGA GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner&nbsp AT2G24765.2 CAATGGGCCGA GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner&nbsp AT2G24860 AT2G24860.1 TTAATGGGCCCAG chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 65 Blast hits to 65 proteins in 20 species: Archae – 0; Bacteria – 8; Metazoa – 8; Fungi – 2; Plants – 40; Viruses – 0; Other Eukaryotes – 7 (source: NCBI BLink).&nbsp AT2G25210 AT2G25210.1 TAAATGGGCCTTTGTGGCCCAAT 60S ribosomal protein L39 (RPL39A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 574 Blast hits to 574 proteins in 219 species: Archae – 142; Bacteria – 0; Metazoa – 205; Fungi – 79; Plants – 70; Viruses – 0; Other Eukaryotes – 78 (source: NCBI BLink).&nbsp AT2G27020 AT2G27020.1 gAATGGGCCAA Encodes 20S proteasome subunit PAG1 (PAG1).&nbsp AT2G27030 AT2G27030.1 TTATTGGGCCTAATGGGCCTTTT encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.&nbsp AT2G27030.2 TTATTGGGCCTAATGGGCCTTTT encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.&nbsp AT2G27030.3 TTATTGGGCCTAATGGGCCTTTT encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.&nbsp AT2G28290 AT2G28290.1 CAAGGCCCATTAAGGGGT Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.&nbsp AT2G28290.2 CAAGGCCCATTAAGGGGT Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.&nbsp AT2G28290.3 CAAGGCCCATTAAGGGGT Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.&nbsp AT2G28480 AT2G28480.1 ATAATGGGCCTGT RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae – 0; Bacteria – 3; Metazoa – 27; Fungi – 0; Plants – 169; Viruses – 0; Other Eukaryotes – 13 (source: NCBI BLink).&nbsp AT2G29360 AT2G29360.1 GAGGCCCATTT tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29150.1); Has 83809 Blast hits to 83613 proteins in 2239 species: Archae – 475; Bacteria – 45716; Metazoa – 5149; Fungi – 4359; Plants – 1662; Viruses – 5; Other Eukaryotes – 26443 (source: NCBI BLink).&nbsp AT2G30060 AT2G30060.1 AATAGGCCCAAAAGGGCCCATTAT Ran-binding protein 1b (RanBP1b); FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: intracellular transport, protein import into nucleus, translocation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ran Binding Protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: SIRANBP; Ran GTPase binding (TAIR:AT1G07140.1); Has 1190 Blast hits to 924 proteins in 176 species: Archae – 0; Bacteria – 3; Metazoa – 728; Fungi – 225; Plants – 88; Viruses – 2; Other Eukaryotes – 144 (source: NCBI BLink).&nbsp AT2G32415 AT2G32415.1 UNEAATGGGCCTGT 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae – 0; Bacteria – 1374; Metazoa – 367; Fungi – 93; Plants – 108; Viruses – 0; Other Eukaryotes – 953 (source: NCBI BLink).&nbsp AT2G33730 AT2G33730.1 CTAATGGGCCTAAA DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae – 661; Bacteria – 41429; Metazoa – 30663; Fungi – 9349; Plants – 3951; Viruses – 317; Other Eukaryotes – 19480 (source: NCBI BLink).&nbsp AT2G33730.1 CTAATGGGCCTAAA DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae – 661; Bacteria – 41429; Metazoa – 30663; Fungi – 9349; Plants – 3951; Viruses – 317; Other Eukaryotes – 19480 (source: NCBI BLink).&nbsp AT2G33840 AT2G33840.1 CTAATGGGCCTTT tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae – 254; Bacteria – 1669; Metazoa – 303; Fungi – 167; Plants – 79; Viruses – 5; Other Eukaryotes – 1169 (source: NCBI BLink).&nbsp AT2G34940 AT2G34940.1 TTAATGGGCTAATGAGGCCCATTAAG vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like calcium-binding (InterPro:IPR001881), Growth factor, receptor (InterPro:IPR009030); BEST Arabidopsis thaliana protein match is: vacuolar sorting receptor, putative (TAIR:AT1G30900.1); Has 9390 Blast hits to 4743 proteins in 196 species: Archae – 0; Bacteria – 100; Metazoa – 8560; Fungi – 5; Plants – 215; Viruses – 0; Other Eukaryotes – 510 (source: NCBI BLink).&nbsp AT2G35320 AT2G35320.1 ATAATGGGCCTTTAATTGGGCCGA homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent.&nbsp AT2G35490 AT2G35490.1 ATAATGGGCCTGG plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae – 0; Bacteria – 78; Metazoa – 1; Fungi – 0; Plants – 205; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT2G35490.1 TCAGGCCCATTAG plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae – 0; Bacteria – 78; Metazoa – 1; Fungi – 0; Plants – 205; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT2G35500 AT2G35500.1 CCAGGCCCATT shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae – 0; Bacteria – 111; Metazoa – 0; Fungi – 0; Plants – 72; Viruses – 0; Other Eukaryotes – 99 (source: NCBI BLink).&nbsp AT2G35500.1 CTAATGGGCCTGA shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae – 0; Bacteria – 111; Metazoa – 0; Fungi – 0; Plants – 72; Viruses – 0; Other Eukaryotes – 99 (source: NCBI BLink).&nbsp AT2G35720 AT2G35720.1 TTAAGGCCCATTAA DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae – 105; Bacteria – 5397; Metazoa – 3297; Fungi – 1386; Plants – 1147; Viruses – 13; Other Eukaryotes – 4442 (source: NCBI BLink).&nbsp AT2G36170 AT2G36170.1 AGGGCCCATTg ubiquitin extension protein 2 (UBQ2) / 60S ribosomal protein L40 (RPL40A); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein modification process, translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L40e (InterPro:IPR001975), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent of ribosome (TAIR:AT3G52590.1); Has 9155 Blast hits to 5428 proteins in 614 species: Archae – 0; Bacteria – 7; Metazoa – 4223; Fungi – 953; Plants – 1966; Viruses – 162; Other Eukaryotes – 1844 (source: NCBI BLink).&nbsp AT2G36485 AT2G36485.1 TAAATGGGCCTAAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae – 0; Bacteria – 0; Metazoa – 30; Fungi – 33; Plants – 24; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G36620 AT2G36620.1 AAAAGGCCCATTAA RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).&nbsp AT2G36680 AT2G36680.1 TAAAGGCCCATTAA LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae – 1; Bacteria – 4; Metazoa – 236; Fungi – 19; Plants – 37; Viruses – 0; Other Eukaryotes – 51 (source: NCBI BLink).&nbsp AT2G36680.2 TAAAGGCCCATTAA LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae – 1; Bacteria – 4; Metazoa – 236; Fungi – 19; Plants – 37; Viruses – 0; Other Eukaryotes – 51 (source: NCBI BLink).&nbsp AT2G36680.3 TAAAGGCCCATTAA LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae – 1; Bacteria – 4; Metazoa – 236; Fungi – 19; Plants – 37; Viruses – 0; Other Eukaryotes – 51 (source: NCBI BLink).&nbsp AT2G36680.4 TAAAGGCCCATTAA LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae – 1; Bacteria – 4; Metazoa – 236; Fungi – 19; Plants – 37; Viruses – 0; Other Eukaryotes – 51 (source: NCBI BLink).&nbsp AT2G36930 AT2G36930.1 TAAATGGGCCTTG zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae – 0; Bacteria – 0; Metazoa – 257; Fungi – 153; Plants – 39; Viruses – 0; Other Eukaryotes – 57 (source: NCBI BLink).&nbsp AT2G36930.1 TTAATGGGCCTAT zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae – 0; Bacteria – 0; Metazoa – 257; Fungi – 153; Plants – 39; Viruses – 0; Other Eukaryotes – 57 (source: NCBI BLink).&nbsp AT2G37160 AT2G37160.1 TAATGGGCCTATA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae – 36; Bacteria – 3543; Metazoa – 4573; Fungi – 2572; Plants – 1053; Viruses – 0; Other Eukaryotes – 2101 (source: NCBI BLink).&nbsp AT2G37160.2 TAATGGGCCTATA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae – 36; Bacteria – 3543; Metazoa – 4573; Fungi – 2572; Plants – 1053; Viruses – 0; Other Eukaryotes – 2101 (source: NCBI BLink).&nbsp AT2G37340 AT2G37340.1 TAAATGGGCCTTAT encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks.&nbsp AT2G37660 AT2G37660.1 ATGGCCCATTT binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae – 20; Bacteria – 1147; Metazoa – 3; Fungi – 23; Plants – 245; Viruses – 0; Other Eukaryotes – 273 (source: NCBI BLink).&nbsp AT2G39445 AT2G39445.1 TTAAAGGCCCATTCGAGGCCCAACA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: PIG-P (InterPro:IPR013717), Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit (InterPro:IPR016542); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61280.1); Has 228 Blast hits to 228 proteins in 105 species: Archae – 0; Bacteria – 0; Metazoa – 106; Fungi – 60; Plants – 24; Viruses – 0; Other Eukaryotes – 38 (source: NCBI BLink).&nbsp AT2G39460 AT2G39460.1 AAAAGGCCCATTAT Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.&nbsp AT2G39460.1 AAAAGGCCCATTTA Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.&nbsp AT2G39460.2 AAAAGGCCCATTAT Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.&nbsp AT2G39460.2 AAAAGGCCCATTTA Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.&nbsp AT2G40113 AT2G40113.1 GAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 27 Blast hits to 27 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 27; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G40316 AT2G40316.1 TAAATGGGCCGTT unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae – 0; Bacteria – 0; Metazoa – 33; Fungi – 39; Plants – 20; Viruses – 0; Other Eukaryotes – 8 (source: NCBI BLink).&nbsp AT2G40316.2 TAAATGGGCCGTT unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae – 0; Bacteria – 0; Metazoa – 33; Fungi – 39; Plants – 20; Viruses – 0; Other Eukaryotes – 8 (source: NCBI BLink).&nbsp AT2G40650 AT2G40650.1 ATAATGGGCCTAG pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae – 56; Bacteria – 20349; Metazoa – 26407; Fungi – 5687; Plants – 2913; Viruses – 323; Other Eukaryotes – 11922 (source: NCBI BLink).&nbsp AT2G40660 AT2G40660.1 CTAGGCCCATTAT tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine–tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae – 158; Bacteria – 2173; Metazoa – 404; Fungi – 148; Plants – 87; Viruses – 1; Other Eukaryotes – 649 (source: NCBI BLink).&nbsp AT2G41780 AT2G41780.1 gGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 4; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G41780.2 gGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 4; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G41840 AT2G41840.1 TCAGGCCCATTTAAGCCCACT 40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae – 183; Bacteria – 3055; Metazoa – 2026; Fungi – 746; Plants – 385; Viruses – 17; Other Eukaryotes – 2632 (source: NCBI BLink).&nbsp AT2G42160 AT2G42160.1 CTAAGGCCCATTAA zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae – 0; Bacteria – 7; Metazoa – 531; Fungi – 172; Plants – 57; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT2G42210 AT2G42210.1 ATAATGGGCCCTAAGAGGCCCACA Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.&nbsp AT2G42210.2 ATAATGGGCCCTAAGAGGCCCACA Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.&nbsp AT2G42210.3 ATAATGGGCCCTAAGAGGCCCACA Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.&nbsp AT2G42210.4 ATAATGGGCCCTAAGAGGCCCACA Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.&nbsp AT2G42230 AT2G42230.1 CTTAATGGGCCGTTTAAAGCCCATTTA tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae – 0; Bacteria – 0; Metazoa – 135; Fungi – 0; Plants – 45; Viruses – 0; Other Eukaryotes – 55 (source: NCBI BLink).&nbsp AT2G42230.2 CTTAATGGGCCGTTTAAAGCCCATTTA tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae – 0; Bacteria – 0; Metazoa – 135; Fungi – 0; Plants – 45; Viruses – 0; Other Eukaryotes – 55 (source: NCBI BLink).&nbsp AT2G42790 AT2G42790.1 TTCGGCCCATTC Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.&nbsp AT2G43640 AT2G43640.1 TACTGGGCCTAATAAGGCCCATTAT signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 27; Plants – 26; Viruses – 0; Other Eukaryotes – 17 (source: NCBI BLink).&nbsp AT2G43640.2 TACTGGGCCTAATAAGGCCCATTAT signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 27; Plants – 26; Viruses – 0; Other Eukaryotes – 17 (source: NCBI BLink).&nbsp AT2G43720 AT2G43720.1 TAAATGGGCCCAATT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 158; Fungi – 0; Plants – 34; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT2G44640 AT2G44640.1 CAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 24; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT2G45460 AT2G45460.1 GTGGCCCATTTA forkhead-associated domain-containing protein / FHA domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253), TSC-22 / Dip / Bun (InterPro:IPR000580); BEST Arabidopsis thaliana protein match is: CIP1 (COP1-INTERACTIVE PROTEIN 1); protein binding (TAIR:AT5G41790.1); Has 72255 Blast hits to 40875 proteins in 1850 species: Archae – 633; Bacteria – 10532; Metazoa – 36222; Fungi – 5255; Plants – 2524; Viruses – 286; Other Eukaryotes – 16803 (source: NCBI BLink).&nbsp AT2G45530 AT2G45530.1 GTAGGCCCATTTA zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae – 0; Bacteria – 0; Metazoa – 262; Fungi – 5; Plants – 312; Viruses – 3; Other Eukaryotes – 39 (source: NCBI BLink).&nbsp AT2G45640 AT2G45640.1 AAAAGGCCCATTAG Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo.&nbsp AT2G46230 AT2G46230.1 ATTAGGCCCATTTA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae – 21; Bacteria – 0; Metazoa – 192; Fungi – 143; Plants – 53; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT2G46230.2 ATTAGGCCCATTTA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae – 21; Bacteria – 0; Metazoa – 192; Fungi – 143; Plants – 53; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT2G46470 AT2G46470.1 TTAAGGCCCATTAAG INNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae – 0; Bacteria – 2560; Metazoa – 212; Fungi – 138; Plants – 111; Viruses – 0; Other Eukaryotes – 1362 (source: NCBI BLink).&nbsp AT2G46540 AT2G46540.1 ATAATGGGCCGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 26; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G46580 AT2G46580.1 ATAAGGCCTAATGGGCCTCA pyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae – 0; Bacteria – 365; Metazoa – 49; Fungi – 36; Plants – 20; Viruses – 0; Other Eukaryotes – 619 (source: NCBI BLink).&nbsp AT2G46600 AT2G46600.1 ACGGCCCATTC calcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 2155 Blast hits to 2154 proteins in 355 species: Archae – 0; Bacteria – 4; Metazoa – 957; Fungi – 168; Plants – 633; Viruses – 0; Other Eukaryotes – 393 (source: NCBI BLink).&nbsp AT2G47120 AT2G47120.1 AGAGGCCCATTAA short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae – 468; Bacteria – 43770; Metazoa – 4463; Fungi – 4181; Plants – 1494; Viruses – 4; Other Eukaryotes – 25931 (source: NCBI BLink).&nbsp AT2G47170 AT2G47170.1 TAAATGGGCCGAATTGGGCTGA Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.&nbsp AT2G47380 AT2G47380.1 TAATGGGCCGG cytochrome c oxidase subunit Vc family protein / COX5C family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase subunit Vc (InterPro:IPR008432); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit Vc, putative / COX5C, putative (TAIR:AT5G61310.4); Has 60 Blast hits to 60 proteins in 15 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 60; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT2G47790 AT2G47790.1 TAAATGGGCCGAA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 8923 Blast hits to 5742 proteins in 332 species: Archae – 8; Bacteria – 1962; Metazoa – 3030; Fungi – 2021; Plants – 501; Viruses – 0; Other Eukaryotes – 1401 (source: NCBI BLink).&nbsp AT2G47840 AT2G47840.1 TATAGGCCCATTTA tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae – 0; Bacteria – 107; Metazoa – 0; Fungi – 0; Plants – 50; Viruses – 0; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT2G47940 AT2G47940.1 AATAGGCCCATTAA Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.&nbsp AT2G47940.1 gGGCCCATTAG Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.&nbsp AT2G47940.2 AATAGGCCCATTAA Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.&nbsp AT2G47940.2 gGGCCCATTAG Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.&nbsp AT2G47960 AT2G47960.1 AACGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae – 0; Bacteria – 0; Metazoa – 131; Fungi – 46; Plants – 18; Viruses – 0; Other Eukaryotes – 20 (source: NCBI BLink).&nbsp AT2G48100 AT2G48100.1 UNEAATGGGCCTTTAA exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae – 0; Bacteria – 10; Metazoa – 634; Fungi – 294; Plants – 142; Viruses – 0; Other Eukaryotes – 85 (source: NCBI BLink).&nbsp AT2G48100.2 UNEAATGGGCCTTTAA exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae – 0; Bacteria – 10; Metazoa – 634; Fungi – 294; Plants – 142; Viruses – 0; Other Eukaryotes – 85 (source: NCBI BLink).&nbsp AT2G48100.3 UNEAATGGGCCTTTAA exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae – 0; Bacteria – 10; Metazoa – 634; Fungi – 294; Plants – 142; Viruses – 0; Other Eukaryotes – 85 (source: NCBI BLink).&nbsp AT2G48100.4 UNEAATGGGCCTTTAA exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae – 0; Bacteria – 10; Metazoa – 634; Fungi – 294; Plants – 142; Viruses – 0; Other Eukaryotes – 85 (source: NCBI BLink).&nbsp AT2G48160 AT2G48160.1 CTAATGGGCCTCA EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae – 2; Bacteria – 174; Metazoa – 679; Fungi – 194; Plants – 113; Viruses – 2; Other Eukaryotes – 128 (source: NCBI BLink).&nbsp AT2G48160.1 TAAATGGGCCAT EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae – 2; Bacteria – 174; Metazoa – 679; Fungi – 194; Plants – 113; Viruses – 2; Other Eukaryotes – 128 (source: NCBI BLink).&nbsp AT3G01100 AT3G01100.1 TTAATGGGCCTTTT unknown protein, has cDNAs and ESTs associated to it&nbsp AT3G01100.2 TTAATGGGCCTTTT unknown protein, has cDNAs and ESTs associated to it&nbsp AT3G01320 AT3G01320.1 TAAATGGGCCTATT Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190).&nbsp AT3G01540 AT3G01540.1 ATAATGGGCCTAG RNA HELICASE DRH1&nbsp AT3G01540.2 ATAATGGGCCTAG RNA HELICASE DRH1&nbsp AT3G01540.3 ATAATGGGCCTAG RNA HELICASE DRH1&nbsp AT3G01540.4 ATAATGGGCCTAG RNA HELICASE DRH1&nbsp AT3G01560 AT3G01560.1 TTCGGCCCATTTA proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Protein of unknown function DUF1421 (InterPro:IPR010820), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT5G14540.1); Has 76923 Blast hits to 40691 proteins in 1566 species: Archae – 110; Bacteria – 8440; Metazoa – 31149; Fungi – 13515; Plants – 10280; Viruses – 1804; Other Eukaryotes – 11625 (source: NCBI BLink).&nbsp AT3G02050 AT3G02050.1 AGCCCATAATGGGCCTGA potassium transporter KUP3p (KUP3)&nbsp AT3G02050.1 TAAATGGGCCTTG potassium transporter KUP3p (KUP3)&nbsp AT3G02080 AT3G02080.1 ATTAGGCCCATTAG 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae – 134; Bacteria – 4; Metazoa – 345; Fungi – 96; Plants – 125; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT3G02090 AT3G02090.1 CTAATGGGCCTAAT MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae – 16; Bacteria – 4766; Metazoa – 826; Fungi – 501; Plants – 201; Viruses – 3; Other Eukaryotes – 2144 (source: NCBI BLink).&nbsp AT3G02090.2 CTAATGGGCCTAAT MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae – 16; Bacteria – 4766; Metazoa – 826; Fungi – 501; Plants – 201; Viruses – 3; Other Eukaryotes – 2144 (source: NCBI BLink).&nbsp AT3G02320 AT3G02320.1 ATGGCCCATTAG RNA binding / tRNA (guanine-N2-)-methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase family protein (TAIR:AT5G15810.1); Has 751 Blast hits to 711 proteins in 254 species: Archae – 149; Bacteria – 57; Metazoa – 179; Fungi – 100; Plants – 52; Viruses – 0; Other Eukaryotes – 214 (source: NCBI BLink).&nbsp AT3G02555 AT3G02555.1 UNEAATGGGCCGTTAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 62; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G02555.1 CAATGGGCCCAATG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 62; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G02560 AT3G02560.1 CATTGGGCCCATTg 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae – 0; Bacteria – 0; Metazoa – 251; Fungi – 93; Plants – 111; Viruses – 0; Other Eukaryotes – 100 (source: NCBI BLink).&nbsp AT3G02560.1 TTTAACGGCCCATTT 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae – 0; Bacteria – 0; Metazoa – 251; Fungi – 93; Plants – 111; Viruses – 0; Other Eukaryotes – 100 (source: NCBI BLink).&nbsp AT3G02560.2 CATTGGGCCCATTg 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae – 0; Bacteria – 0; Metazoa – 251; Fungi – 93; Plants – 111; Viruses – 0; Other Eukaryotes – 100 (source: NCBI BLink).&nbsp AT3G02560.2 TTTAACGGCCCATTT 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae – 0; Bacteria – 0; Metazoa – 251; Fungi – 93; Plants – 111; Viruses – 0; Other Eukaryotes – 100 (source: NCBI BLink).&nbsp AT3G02640 AT3G02640.1 TTGGCCCATTGGGCTTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16250.1); Has 58 Blast hits to 58 proteins in 11 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 57; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT3G03010 AT3G03010.1 UNEAATGGGCCGTT aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae – 158; Bacteria – 4; Metazoa – 158; Fungi – 86; Plants – 40; Viruses – 8; Other Eukaryotes – 171 (source: NCBI BLink).&nbsp AT3G03010.2 UNEAATGGGCCGTT aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae – 158; Bacteria – 4; Metazoa – 158; Fungi – 86; Plants – 40; Viruses – 8; Other Eukaryotes – 171 (source: NCBI BLink).&nbsp AT3G03020 AT3G03020.1 AACGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 4; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G03020.2 AACGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 4; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G03130 AT3G03130.1 TTTAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae – 10; Bacteria – 2333; Metazoa – 1613; Fungi – 601; Plants – 171; Viruses – 56; Other Eukaryotes – 1727 (source: NCBI BLink).&nbsp AT3G03600 AT3G03600.1 UNEAATGGGCCGG Structural component of the mitochondrial ribosome small subunit&nbsp AT3G03610 AT3G03610.1 DCGGCCCATTT phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae – 0; Bacteria – 0; Metazoa – 422; Fungi – 25; Plants – 106; Viruses – 0; Other Eukaryotes – 83 (source: NCBI BLink).&nbsp AT3G03920 AT3G03920.1 TGAGGCCCATTAG Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae – 15; Bacteria – 4613; Metazoa – 10704; Fungi – 2027; Plants – 5901; Viruses – 362; Other Eukaryotes – 2624 (source: NCBI BLink).&nbsp AT3G04160 AT3G04160.1 CTAATGGGCCTAATTAAATGGGC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae – 0; Bacteria – 45; Metazoa – 652; Fungi – 193; Plants – 164; Viruses – 0; Other Eukaryotes – 545 (source: NCBI BLink).&nbsp AT3G04620 AT3G04620.1 CTTAGGCCCATTTA nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 68; Viruses – 0; Other Eukaryotes – 21 (source: NCBI BLink).&nbsp AT3G04620.1 TCAGGCCCATTTA nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 68; Viruses – 0; Other Eukaryotes – 21 (source: NCBI BLink).&nbsp AT3G05060 AT3G05060.1 TCAGGCCCATTAA SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein&nbsp AT3G05070 AT3G05070.1 TTAATGGGCCTGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae – 0; Bacteria – 0; Metazoa – 107; Fungi – 54; Plants – 17; Viruses – 9; Other Eukaryotes – 34 (source: NCBI BLink).&nbsp AT3G05590 AT3G05590.1 TAAATGGGCCAAT Encodes cytoplasmic ribosomal protein L18.&nbsp AT3G05810 AT3G05810.1 TTAATGGGCTAGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26800.1); Has 32 Blast hits to 32 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 32; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G06030 AT3G06030.1 AAAAAGCCCAATAAGAAGGCCCATTAAG NPK1-related protein kinase 3&nbsp AT3G06270 AT3G06270.1 GGGCCTTAGGCCCATTAG protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae – 2; Bacteria – 83; Metazoa – 1132; Fungi – 383; Plants – 1219; Viruses – 4; Other Eukaryotes – 863 (source: NCBI BLink).&nbsp AT3G06470 AT3G06470.1 CAATGGGCCTAT GNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT3G06460.1); Has 1723 Blast hits to 1718 proteins in 184 species: Archae – 0; Bacteria – 0; Metazoa – 1179; Fungi – 248; Plants – 58; Viruses – 13; Other Eukaryotes – 225 (source: NCBI BLink).&nbsp AT3G06510 AT3G06510.1 ACGCCGTTTCAATGGGCC Encodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing&nbsp AT3G06510.2 ACGCCGTTTCAATGGGCC Encodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing&nbsp AT3G06540 AT3G06540.1 CTTAGGCCCATTUNE GDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae – 0; Bacteria – 2; Metazoa – 512; Fungi – 195; Plants – 103; Viruses – 0; Other Eukaryotes – 136 (source: NCBI BLink).&nbsp AT3G07568 AT3G07568.1 CTAATGGGCCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 6; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G08630 AT3G08630.1 UNEAATGGGCCC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: alphavirus core protein family (TAIR:AT3G08640.1); Has 3471 Blast hits to 1913 proteins in 226 species: Archae – 0; Bacteria – 450; Metazoa – 1700; Fungi – 130; Plants – 787; Viruses – 19; Other Eukaryotes – 385 (source: NCBI BLink).&nbsp AT3G08640 AT3G08640.1 CGCACGTGGGAAATGGGCCGAT alphavirus core protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08630.1); Has 10912 Blast hits to 4701 proteins in 450 species: Archae – 4; Bacteria – 2405; Metazoa – 4145; Fungi – 556; Plants – 2369; Viruses – 93; Other Eukaryotes – 1340 (source: NCBI BLink).&nbsp AT3G09080 AT3G09080.1 TTATGGGCCCATTT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae – 36; Bacteria – 2713; Metazoa – 3924; Fungi – 1952; Plants – 817; Viruses – 0; Other Eukaryotes – 1604 (source: NCBI BLink).&nbsp AT3G09085 AT3G09085.1 UNEAATGGGCCCATAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae – 0; Bacteria – 294; Metazoa – 0; Fungi – 2; Plants – 21; Viruses – 0; Other Eukaryotes – 233 (source: NCBI BLink).&nbsp AT3G09200 AT3G09200.1 TAAATGGGCCTAAT 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae – 223; Bacteria – 1; Metazoa – 420; Fungi – 182; Plants – 109; Viruses – 0; Other Eukaryotes – 277 (source: NCBI BLink).&nbsp AT3G09200.2 TAAATGGGCCTAAT 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae – 223; Bacteria – 1; Metazoa – 420; Fungi – 182; Plants – 109; Viruses – 0; Other Eukaryotes – 277 (source: NCBI BLink).&nbsp AT3G09470 AT3G09470.1 AAAAGGCCAAGGCCCATTAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae – 2; Bacteria – 10; Metazoa – 433; Fungi – 116; Plants – 40; Viruses – 0; Other Eukaryotes – 37 (source: NCBI BLink).&nbsp AT3G09470.2 AAAAGGCCAAGGCCCATTAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae – 2; Bacteria – 10; Metazoa – 433; Fungi – 116; Plants – 40; Viruses – 0; Other Eukaryotes – 37 (source: NCBI BLink).&nbsp AT3G09480 AT3G09480.1 AAAAGGCCAAGGCCCATTAG histone H2B, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT5G02570.1); Has 2678 Blast hits to 2678 proteins in 284 species: Archae – 0; Bacteria – 0; Metazoa – 1868; Fungi – 162; Plants – 357; Viruses – 0; Other Eukaryotes – 291 (source: NCBI BLink).&nbsp AT3G09490 AT3G09490.1 CTAATGGGCCTTGGCCTTTT chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 637 Blast hits to 548 proteins in 146 species: Archae – 92; Bacteria – 301; Metazoa – 8; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 195 (source: NCBI BLink).&nbsp AT3G09500 AT3G09500.1 ATGGGCTAAGGCCCATTAAG 60S ribosomal protein L35 (RPL35A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 829 Blast hits to 829 proteins in 305 species: Archae – 115; Bacteria – 131; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 163 (source: NCBI BLink).&nbsp AT3G09720 AT3G09720.1 ATTTGGGCTTTAATAGGCCCATTTA DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae – 599; Bacteria – 13582; Metazoa – 5089; Fungi – 3376; Plants – 1453; Viruses – 31; Other Eukaryotes – 7222 (source: NCBI BLink).&nbsp AT3G09850 AT3G09850.1 TACGTGGCCCATTT D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 3479 Blast hits to 2376 proteins in 234 species: Archae – 15; Bacteria – 783; Metazoa – 1588; Fungi – 375; Plants – 208; Viruses – 9; Other Eukaryotes – 501 (source: NCBI BLink).&nbsp AT3G09860 AT3G09860.1 UNEAATGGGCCACGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 21; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G10110 AT3G10110.1 CTAATGGGCCTAAA maternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae – 0; Bacteria – 0; Metazoa – 226; Fungi – 159; Plants – 86; Viruses – 0; Other Eukaryotes – 38 (source: NCBI BLink).&nbsp AT3G10300 AT3G10300.1 TTAATGGGCCTCA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae – 0; Bacteria – 2811; Metazoa – 19727; Fungi – 3988; Plants – 3787; Viruses – 272; Other Eukaryotes – 3054 (source: NCBI BLink).&nbsp AT3G10300.2 TTAATGGGCCTCA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae – 0; Bacteria – 2811; Metazoa – 19727; Fungi – 3988; Plants – 3787; Viruses – 272; Other Eukaryotes – 3054 (source: NCBI BLink).&nbsp AT3G10300.3 TTAATGGGCCTCA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae – 0; Bacteria – 2811; Metazoa – 19727; Fungi – 3988; Plants – 3787; Viruses – 272; Other Eukaryotes – 3054 (source: NCBI BLink).&nbsp AT3G10300.4 TTAATGGGCCTCA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae – 0; Bacteria – 2811; Metazoa – 19727; Fungi – 3988; Plants – 3787; Viruses – 272; Other Eukaryotes – 3054 (source: NCBI BLink).&nbsp AT3G10572 AT3G10572.1 ATGGCCCATTAA 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 11; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G10630 AT3G10630.1 CTTAATGGGCCTCT glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae – 97; Bacteria – 1438; Metazoa – 0; Fungi – 0; Plants – 27; Viruses – 3; Other Eukaryotes – 935 (source: NCBI BLink).&nbsp AT3G10630.1 TAAATGGGCCAT glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae – 97; Bacteria – 1438; Metazoa – 0; Fungi – 0; Plants – 27; Viruses – 3; Other Eukaryotes – 935 (source: NCBI BLink).&nbsp AT3G10970 AT3G10970.1 TGGCCCATTAA haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae – 20; Bacteria – 1836; Metazoa – 9; Fungi – 4; Plants – 93; Viruses – 0; Other Eukaryotes – 184 (source: NCBI BLink).&nbsp AT3G10970.2 TGGCCCATTAA haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae – 20; Bacteria – 1836; Metazoa – 9; Fungi – 4; Plants – 93; Viruses – 0; Other Eukaryotes – 184 (source: NCBI BLink).&nbsp AT3G10970.3 TGGCCCATTAA haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae – 20; Bacteria – 1836; Metazoa – 9; Fungi – 4; Plants – 93; Viruses – 0; Other Eukaryotes – 184 (source: NCBI BLink).&nbsp AT3G11730 AT3G11730.1 TCGGCCCATTTA Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein.&nbsp AT3G12100 AT3G12100.1 GTGGCCCATTg cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae – 81; Bacteria – 2187; Metazoa – 847; Fungi – 320; Plants – 155; Viruses – 0; Other Eukaryotes – 244 (source: NCBI BLink).&nbsp AT3G12100.2 GTGGCCCATTg cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae – 81; Bacteria – 2187; Metazoa – 847; Fungi – 320; Plants – 155; Viruses – 0; Other Eukaryotes – 244 (source: NCBI BLink).&nbsp AT3G12600 AT3G12600.1 gAATGGGCCCAATAAG Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae – 0; Bacteria – 257; Metazoa – 210; Fungi – 81; Plants – 132; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT3G12600.1 TGGGCCCATTAAACCGAA Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae – 0; Bacteria – 257; Metazoa – 210; Fungi – 81; Plants – 132; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT3G12600.2 gAATGGGCCCAATAAG Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae – 0; Bacteria – 257; Metazoa – 210; Fungi – 81; Plants – 132; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT3G12600.2 TGGGCCCATTAAACCGAA Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae – 0; Bacteria – 257; Metazoa – 210; Fungi – 81; Plants – 132; Viruses – 0; Other Eukaryotes – 84 (source: NCBI BLink).&nbsp AT3G12870 AT3G12870.1 TTAATGGGCCUNE unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56120.1); Has 45 Blast hits to 45 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 45; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G12930 AT3G12930.1 ACAGGCCCATTT INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 2517 Blast hits to 2517 proteins in 833 species: Archae – 0; Bacteria – 1551; Metazoa – 22; Fungi – 0; Plants – 35; Viruses – 0; Other Eukaryotes – 909 (source: NCBI BLink).&nbsp AT3G13050 AT3G13050.1 UNEAATGGGCCTTAC transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae – 383; Bacteria – 12067; Metazoa – 4488; Fungi – 4369; Plants – 1324; Viruses – 0; Other Eukaryotes – 1430 (source: NCBI BLink).&nbsp AT3G13190 AT3G13190.1 TTAATGGGCCTAAAAGCCCATA myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae – 329; Bacteria – 2603; Metazoa – 12748; Fungi – 1596; Plants – 1122; Viruses – 98; Other Eukaryotes – 5752 (source: NCBI BLink).&nbsp AT3G13190.2 TTAATGGGCCTAAAAGCCCATA myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae – 329; Bacteria – 2603; Metazoa – 12748; Fungi – 1596; Plants – 1122; Viruses – 98; Other Eukaryotes – 5752 (source: NCBI BLink).&nbsp AT3G13190.3 TTAATGGGCCTAAAAGCCCATA myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae – 329; Bacteria – 2603; Metazoa – 12748; Fungi – 1596; Plants – 1122; Viruses – 98; Other Eukaryotes – 5752 (source: NCBI BLink).&nbsp AT3G13275 AT3G13275.1 TTAATGGGCCTTAGGCCCAATAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 13; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G13360 AT3G13360.1 TTAATGGGCCTTAT WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae – 0; Bacteria – 7; Metazoa – 18; Fungi – 8; Plants – 43; Viruses – 0; Other Eukaryotes – 54 (source: NCBI BLink).&nbsp AT3G13470 AT3G13470.1 TAATGGGCCTATT chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae – 390; Bacteria – 14009; Metazoa – 1525; Fungi – 954; Plants – 450; Viruses – 2; Other Eukaryotes – 7156 (source: NCBI BLink).&nbsp AT3G13860 AT3G13860.1 ATAATGGGCCTAAG HEAT SHOCK PROTEIN 60-3A (HSP60-3A); FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: HSP60 (HEAT SHOCK PROTEIN 60); ATP binding (TAIR:AT3G23990.1); Has 24236 Blast hits to 24217 proteins in 5120 species: Archae – 378; Bacteria – 14012; Metazoa – 1390; Fungi – 947; Plants – 418; Viruses – 2; Other Eukaryotes – 7089 (source: NCBI BLink).&nbsp AT3G13930 AT3G13930.1 ATTAGGCCCATTAA dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae – 43; Bacteria – 6315; Metazoa – 646; Fungi – 315; Plants – 198; Viruses – 0; Other Eukaryotes – 7611 (source: NCBI BLink).&nbsp AT3G14290 AT3G14290.1 TTTAGGCCCATTAA Encodes 20S proteasome subunit PAE2 (PAE2).&nbsp AT3G14390 AT3G14390.1 UNEAATGGGCCUNE diaminopimelate decarboxylase, putative / DAP carboxylase, putative; FUNCTIONS IN: diaminopimelate decarboxylase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Diaminopimelate decarboxylase (InterPro:IPR002986), Alanine racemase/group IV decarboxylase, C-terminal (InterPro:IPR009006), Orn/DAP/Arg decarboxylase 2 (InterPro:IPR000183); BEST Arabidopsis thaliana protein match is: diaminopimelate decarboxylase, putative / DAP carboxylase, putative (TAIR:AT5G11880.1); Has 9248 Blast hits to 9226 proteins in 1454 species: Archae – 98; Bacteria – 4313; Metazoa – 392; Fungi – 133; Plants – 315; Viruses – 27; Other Eukaryotes – 3970 (source: NCBI BLink).&nbsp AT3G14730 AT3G14730.1 TAAATGGGCCTATT pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae – 0; Bacteria – 0; Metazoa – 53; Fungi – 48; Plants – 14121; Viruses – 0; Other Eukaryotes – 211 (source: NCBI BLink).&nbsp AT3G14830 AT3G14830.1 AGAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G14830.2 AGAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G14860 AT3G14860.1 CTTAATGGGCCTATTATAAGGCCCATAA NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae – 75; Bacteria – 803; Metazoa – 45; Fungi – 0; Plants – 91; Viruses – 0; Other Eukaryotes – 573 (source: NCBI BLink).&nbsp AT3G14860.2 CTTAATGGGCCTATTATAAGGCCCATAA NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae – 75; Bacteria – 803; Metazoa – 45; Fungi – 0; Plants – 91; Viruses – 0; Other Eukaryotes – 573 (source: NCBI BLink).&nbsp AT3G15180 AT3G15180.1 CTAATGGGCCTTAT proteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae – 0; Bacteria – 1; Metazoa – 56; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT3G15180.1 TAAATGGGCCAGGCCTTAT proteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae – 0; Bacteria – 1; Metazoa – 56; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT3G15180.1 TAAATGGGCCAGGCCTTAT proteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae – 0; Bacteria – 1; Metazoa – 56; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT3G15280 AT3G15280.1 ATAATGGGCCTAAA unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 1; Fungi – 0; Plants – 18; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G15290 AT3G15290.1 TTTAGGCCCATTAT 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae – 201; Bacteria – 5136; Metazoa – 507; Fungi – 164; Plants – 85; Viruses – 0; Other Eukaryotes – 3919 (source: NCBI BLink).&nbsp AT3G15352 AT3G15352.1 UNEAATGGGCCTAGCCCACT Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.&nbsp AT3G15420 AT3G15420.1 TAATGGGCCCAAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 17; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G15430 AT3G15430.1 TTTTGGGCCCATTUNE regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae – 48; Bacteria – 1354; Metazoa – 5756; Fungi – 735; Plants – 1385; Viruses – 4; Other Eukaryotes – 4073 (source: NCBI BLink).&nbsp AT3G15430.2 TTTTGGGCCCATTUNE regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae – 48; Bacteria – 1354; Metazoa – 5756; Fungi – 735; Plants – 1385; Viruses – 4; Other Eukaryotes – 4073 (source: NCBI BLink).&nbsp AT3G15460 AT3G15460.1 DCGGCCCATTg brix domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: brix domain-containing protein (TAIR:AT1G52930.1); Has 299 Blast hits to 299 proteins in 145 species: Archae – 0; Bacteria – 0; Metazoa – 109; Fungi – 88; Plants – 33; Viruses – 0; Other Eukaryotes – 69 (source: NCBI BLink).&nbsp AT3G16080 AT3G16080.1 CCAGGCCCATTTA 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae – 202; Bacteria – 0; Metazoa – 220; Fungi – 103; Plants – 72; Viruses – 0; Other Eukaryotes – 110 (source: NCBI BLink).&nbsp AT3G16420 AT3G16420.1 TTAATGGGCCAA The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.&nbsp AT3G16420.2 TTAATGGGCCAA The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.&nbsp AT3G16420.3 TTAATGGGCCAA The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.&nbsp AT3G16700 AT3G16700.1 TATATGGGCCAATAATGGGCCATA fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae – 132; Bacteria – 3815; Metazoa – 259; Fungi – 271; Plants – 44; Viruses – 0; Other Eukaryotes – 3026 (source: NCBI BLink).&nbsp AT3G16700.2 TATATGGGCCAATAATGGGCCATA fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae – 132; Bacteria – 3815; Metazoa – 259; Fungi – 271; Plants – 44; Viruses – 0; Other Eukaryotes – 3026 (source: NCBI BLink).&nbsp AT3G16780 AT3G16780.1 ATAATGGGCCAA 60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae – 206; Bacteria – 0; Metazoa – 265; Fungi – 106; Plants – 93; Viruses – 0; Other Eukaryotes – 178 (source: NCBI BLink).&nbsp AT3G16780.1 GTAGGCCCATTTA 60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae – 206; Bacteria – 0; Metazoa – 265; Fungi – 106; Plants – 93; Viruses – 0; Other Eukaryotes – 178 (source: NCBI BLink).&nbsp AT3G16990 AT3G16990.1 AATAGGCCTTGGCCCATTAA TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae – 21; Bacteria – 69; Metazoa – 0; Fungi – 17; Plants – 26; Viruses – 0; Other Eukaryotes – 68 (source: NCBI BLink).&nbsp AT3G17000 AT3G17000.1 TTAATGGGCCAAGGCCTATT ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae – 0; Bacteria – 0; Metazoa – 2855; Fungi – 1053; Plants – 896; Viruses – 16; Other Eukaryotes – 990 (source: NCBI BLink).&nbsp AT3G17300 AT3G17300.1 TAAATGGGCCGTT EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT3G17300.2 TAAATGGGCCGTT EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT3G17680 AT3G17680.1 CAATGGGCCg FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48405.1); Has 75 Blast hits to 73 proteins in 16 species: Archae – 0; Bacteria – 2; Metazoa – 5; Fungi – 2; Plants – 52; Viruses – 0; Other Eukaryotes – 14 (source: NCBI BLink).&nbsp AT3G17930 AT3G17930.1 TTGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 195 Blast hits to 195 proteins in 62 species: Archae – 0; Bacteria – 98; Metazoa – 0; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 75 (source: NCBI BLink).&nbsp AT3G18030 AT3G18030.1 ATGGCCCATTT flavin mononucleotide flavoprotein involved in salt and osmotic tolerance HAL3A encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis. HAL3A is predominant over another gene with the presumably same function (HAL3B).&nbsp AT3G18130 AT3G18130.1 AGAGGCCCATTTA Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B.&nbsp AT3G18190 AT3G18190.1 ACAGGCCCATTTA chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae – 394; Bacteria – 6460; Metazoa – 1798; Fungi – 981; Plants – 478; Viruses – 2; Other Eukaryotes – 4321 (source: NCBI BLink).&nbsp AT3G18210 AT3G18210.1 TTAATGGGCCg oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae – 0; Bacteria – 16; Metazoa – 224; Fungi – 0; Plants – 36; Viruses – 3; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT3G18210.2 TTAATGGGCCg oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae – 0; Bacteria – 16; Metazoa – 224; Fungi – 0; Plants – 36; Viruses – 3; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT3G18215 AT3G18215.1 CGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae – 0; Bacteria – 72; Metazoa – 0; Fungi – 0; Plants – 96; Viruses – 0; Other Eukaryotes – 12 (source: NCBI BLink).&nbsp AT3G18380 AT3G18380.1 UNEAATGGGCCTTTAATGGG sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 44; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G18380.2 UNEAATGGGCCTTTAATGGG sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 44; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G18390 AT3G18390.1 CCCATTAAAGGCCCATTT embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae – 5; Bacteria – 10; Metazoa – 293; Fungi – 119; Plants – 305; Viruses – 46; Other Eukaryotes – 371 (source: NCBI BLink).&nbsp AT3G19130 AT3G19130.1 TAAATGGGCCC RNA-binding protein 47B (ATRBP47B); FUNCTIONS IN: RNA binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP47A (Arabidopsis thaliana RNA-binding protein 47a); RNA binding (TAIR:AT1G49600.1); Has 30014 Blast hits to 17093 proteins in 630 species: Archae – 14; Bacteria – 1495; Metazoa – 16452; Fungi – 3232; Plants – 4155; Viruses – 9; Other Eukaryotes – 4657 (source: NCBI BLink).&nbsp AT3G19508 AT3G19508.1 TTAAAGGCCCATTAAG unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 17; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G20020 AT3G20020.1 ATTGGCCCATTUNE PROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae – 81; Bacteria – 1747; Metazoa – 1005; Fungi – 174; Plants – 198; Viruses – 0; Other Eukaryotes – 430 (source: NCBI BLink).&nbsp AT3G20020.2 ATTGGCCCATTUNE PROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae – 81; Bacteria – 1747; Metazoa – 1005; Fungi – 174; Plants – 198; Viruses – 0; Other Eukaryotes – 430 (source: NCBI BLink).&nbsp AT3G21110 AT3G21110.1 TTGGCCCATTTA 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone.&nbsp AT3G21110.2 TTGGCCCATTTA 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone.&nbsp AT3G21790 AT3G21790.1 CTAATGGGCCTTAA UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae – 0; Bacteria – 82; Metazoa – 1698; Fungi – 10; Plants – 2668; Viruses – 11; Other Eukaryotes – 24 (source: NCBI BLink).&nbsp AT3G22230 AT3G22230.1 TTAATGGGCCGAA 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae – 0; Bacteria – 0; Metazoa – 292; Fungi – 102; Plants – 95; Viruses – 0; Other Eukaryotes – 114 (source: NCBI BLink).&nbsp AT3G22630 AT3G22630.1 TAAATGGGCCTTAT Encodes 20S proteasome beta subunit PBD1 (PBD1).&nbsp AT3G22780 AT3G22780.1 gAATGGGCCTGA putative DNA binding protein (tso1) mRNA, tso1-3 allele,&nbsp AT3G23390 AT3G23390.1 AGATGGGCCCATTg 60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae – 104; Bacteria – 1; Metazoa – 299; Fungi – 120; Plants – 71; Viruses – 0; Other Eukaryotes – 155 (source: NCBI BLink).&nbsp AT3G24490 AT3G24490.1 TTGGCCCATTAG transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae – 0; Bacteria – 71; Metazoa – 1163; Fungi – 123; Plants – 222; Viruses – 36; Other Eukaryotes – 873 (source: NCBI BLink).&nbsp AT3G24570 AT3G24570.1 TTAATGGGCCGG peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, integral to membrane, peroxisomal membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane 22 kDa family protein (TAIR:AT5G43140.1); Has 898 Blast hits to 898 proteins in 132 species: Archae – 0; Bacteria – 0; Metazoa – 471; Fungi – 216; Plants – 153; Viruses – 0; Other Eukaryotes – 58 (source: NCBI BLink).&nbsp AT3G24820 AT3G24820.1 CCAGGCCCATTT BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae – 0; Bacteria – 0; Metazoa – 11; Fungi – 0; Plants – 81; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT3G24830 AT3G24830.1 UNEAATGGGCCTGG 60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae – 212; Bacteria – 283; Metazoa – 292; Fungi – 127; Plants – 164; Viruses – 0; Other Eukaryotes – 395 (source: NCBI BLink).&nbsp AT3G25220 AT3G25220.1 ATAGGCCCATTUNE immunophilin (FKBP15-1)&nbsp AT3G25520 AT3G25520.1 TAAAAGCCCATAGGCCCATTAA Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.&nbsp AT3G27160 AT3G27160.1 ATAATGGGCCTTAT GHS1 encodes plastid ribosomal protein S21&nbsp AT3G27240 AT3G27240.1 TTGGCCCATTAAGGCCCAAAT cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT5G40810.1); Has 2901 Blast hits to 2901 proteins in 507 species: Archae – 0; Bacteria – 704; Metazoa – 170; Fungi – 165; Plants – 63; Viruses – 0; Other Eukaryotes – 1799 (source: NCBI BLink).&nbsp AT3G27430 AT3G27430.1 AAAAGGCCCATTTA Encodes 20S proteasome beta subunit PBB1 (PBB1).&nbsp AT3G27430.2 AAAAGGCCCATTTA Encodes 20S proteasome beta subunit PBB1 (PBB1).&nbsp AT3G27530 AT3G27530.1 TAAATGGGCCCATAT This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC6 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (225 aa) portion of the protein.&nbsp AT3G27630 AT3G27630.1 ATGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 16; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G28500 AT3G28500.1 AAAAGGCCCATTAA 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae – 48; Bacteria – 1; Metazoa – 282; Fungi – 204; Plants – 184; Viruses – 0; Other Eukaryotes – 199 (source: NCBI BLink).&nbsp AT3G28500.1 ATAAGGCCCATTAA 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae – 48; Bacteria – 1; Metazoa – 282; Fungi – 204; Plants – 184; Viruses – 0; Other Eukaryotes – 199 (source: NCBI BLink).&nbsp AT3G43230 AT3G43230.1 CAAGGCCCATTGGGCCCT zinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: phosphoinositide binding / zinc ion binding (TAIR:AT1G29800.2); Has 3031 Blast hits to 2947 proteins in 232 species: Archae – 0; Bacteria – 157; Metazoa – 1828; Fungi – 464; Plants – 196; Viruses – 3; Other Eukaryotes – 383 (source: NCBI BLink).&nbsp AT3G43850 AT3G43850.1 gAATGGGCCTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21940.1); Has 126 Blast hits to 126 proteins in 14 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 124; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT3G46020 AT3G46020.1 CTTAATGGCCCATTTA RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae – 8; Bacteria – 979; Metazoa – 12428; Fungi – 2358; Plants – 2944; Viruses – 0; Other Eukaryotes – 2115 (source: NCBI BLink).&nbsp AT3G46030 AT3G46030.1 CTTAATGGCCCATTTA HTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae – 0; Bacteria – 1; Metazoa – 1863; Fungi – 166; Plants – 361; Viruses – 0; Other Eukaryotes – 330 (source: NCBI BLink).&nbsp AT3G46040 AT3G46040.1 UNEAATGGGCCTAAT Regulated by TCP20.&nbsp AT3G46040.1 ATAATGGGCCTAG Regulated by TCP20.&nbsp AT3G46040.1 TAAATGGGCCATTAAG Regulated by TCP20.&nbsp AT3G46230 AT3G46230.1 TTAAGGCCCATTAA member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds&nbsp AT3G46310 AT3G46310.1 TAAATGGGCCTAAGCCCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 19; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G46580 AT3G46580.1 CTTAATGGGCCCAAAAGCCCAAAA Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.&nbsp AT3G46790 AT3G46790.1 AAGGCCCATTT Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation.&nbsp AT3G47120 AT3G47120.1 TAAATGGGCCTCA RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae – 10; Bacteria – 1203; Metazoa – 11844; Fungi – 2178; Plants – 3009; Viruses – 0; Other Eukaryotes – 2549 (source: NCBI BLink).&nbsp AT3G47700 AT3G47700.1 AGGGCCCATTAA Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins.&nbsp AT3G47960 AT3G47960.1 UNEAATGGGCCTAC proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae – 0; Bacteria – 385; Metazoa – 535; Fungi – 246; Plants – 1124; Viruses – 0; Other Eukaryotes – 65 (source: NCBI BLink).&nbsp AT3G48680 AT3G48680.1 CTAATGGGCCTCT Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex.&nbsp AT3G49500 AT3G49500.1 TAAATGGGCCTAT Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance.&nbsp AT3G49910 AT3G49910.1 AGAGGCCCATTAT 60S ribosomal protein L26 (RPL26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26B) (TAIR:AT5G67510.1); Has 870 Blast hits to 870 proteins in 315 species: Archae – 232; Bacteria – 6; Metazoa – 311; Fungi – 91; Plants – 68; Viruses – 0; Other Eukaryotes – 162 (source: NCBI BLink).&nbsp AT3G50080 AT3G50080.1 TTATTGGGCCTTTATGGCCCATTAG Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes.&nbsp AT3G50590 AT3G50590.1 TTAAAGCCCATTTAGGCCCATTAAACGACA nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae – 0; Bacteria – 344; Metazoa – 848; Fungi – 287; Plants – 145; Viruses – 23; Other Eukaryotes – 233 (source: NCBI BLink).&nbsp AT3G50808 AT3G50808.1 CTTAATGGGCCGA unknown protein.&nbsp AT3G51010 AT3G51010.1 TATAGGCCCATAAGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 13; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G51820 AT3G51820.1 ACTGGGCCCATTC Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.&nbsp AT3G51820.1 TTAAACCGGGCCCATTC Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.&nbsp AT3G51940 AT3G51940.1 ATTAGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03990.1); Has 134 Blast hits to 107 proteins in 33 species: Archae – 0; Bacteria – 32; Metazoa – 27; Fungi – 16; Plants – 34; Viruses – 0; Other Eukaryotes – 25 (source: NCBI BLink).&nbsp AT3G52220 AT3G52220.1 CTAATGGGCCTAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae – 10; Bacteria – 152; Metazoa – 4787; Fungi – 1223; Plants – 656; Viruses – 23; Other Eukaryotes – 2756 (source: NCBI BLink).&nbsp AT3G52230 AT3G52230.1 TTTAGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 3; Fungi – 0; Plants – 19; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G52340 AT3G52340.1 TAATGGGCCAT sucrose-phosphatase (SPP2)&nbsp AT3G52340.2 TAATGGGCCAT sucrose-phosphatase (SPP2)&nbsp AT3G52340.3 TAATGGGCCAT sucrose-phosphatase (SPP2)&nbsp AT3G52420 AT3G52420.1 GAAGCCCAAACCGGCCCATTT encodes a 7 kDa chloroplast outer envelope membrane protein.&nbsp AT3G52480 AT3G52480.1 UNEAATGGGCCGTTAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 11; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G52750 AT3G52750.1 TATAGGCCCATTTA Nuclear gene that encodes a plastidial division protein (FtsZ2-2).&nbsp AT3G52860 AT3G52860.1 TAAATGGGCCCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae – 0; Bacteria – 2; Metazoa – 36; Fungi – 13; Plants – 13; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT3G52870 AT3G52870.1 UNEAATGGGCCAT calmodulin-binding family protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT3G13600.1); Has 194 Blast hits to 147 proteins in 38 species: Archae – 0; Bacteria – 6; Metazoa – 0; Fungi – 80; Plants – 105; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT3G52960 AT3G52960.1 GTAGGCCCATTAAGGCCCAATAACGGCGT peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae – 43; Bacteria – 1005; Metazoa – 160; Fungi – 217; Plants – 175; Viruses – 0; Other Eukaryotes – 1729 (source: NCBI BLink).&nbsp AT3G54210 AT3G54210.1 TATAGGCCCATTAAGGCCCATCA ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae – 0; Bacteria – 3017; Metazoa – 102; Fungi – 83; Plants – 73; Viruses – 0; Other Eukaryotes – 2110 (source: NCBI BLink).&nbsp AT3G54360 AT3G54360.1 CAGGCCCATTTA protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 679 Blast hits to 624 proteins in 99 species: Archae – 16; Bacteria – 83; Metazoa – 469; Fungi – 12; Plants – 26; Viruses – 8; Other Eukaryotes – 65 (source: NCBI BLink).&nbsp AT3G54860 AT3G54860.1 TGAGGCCCATTUNE Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.&nbsp AT3G54860.1 TGAGGCCCATTTCTAAGCCCATTTA Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.&nbsp AT3G54860.2 TGAGGCCCATTUNE Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.&nbsp AT3G54860.2 TGAGGCCCATTTCTAAGCCCATTTA Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.&nbsp AT3G55170 AT3G55170.1 TGAGGCCCATTTA 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae – 116; Bacteria – 162; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT3G55170.1 TTAAGGCCCATTTA 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae – 116; Bacteria – 162; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT3G55170.2 TGAGGCCCATTTA 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae – 116; Bacteria – 162; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT3G55170.2 TTAAGGCCCATTTA 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae – 116; Bacteria – 162; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT3G55440 AT3G55440.1 TTAATGGGCCTAAAGCCCATA Encodes triosephosphate isomerase.&nbsp AT3G55460 AT3G55460.1 TAAATGGGCCAA encodes an SC35-like splicing factor that is localized to nuclear specks.&nbsp AT3G56210 AT3G56210.1 AAGGCCCATTAG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 32; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G56210.2 AAGGCCCATTAG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 32; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G56210.4 AAGGCCCATTAG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 32; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G56440 AT3G56440.1 AGAGGCCCATTAAG AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae – 0; Bacteria – 24; Metazoa – 508; Fungi – 305; Plants – 110; Viruses – 0; Other Eukaryotes – 146 (source: NCBI BLink).&nbsp AT3G56990 AT3G56990.1 AATAGGCCCATTAAG embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae – 0; Bacteria – 215; Metazoa – 1552; Fungi – 648; Plants – 432; Viruses – 52; Other Eukaryotes – 536 (source: NCBI BLink).&nbsp AT3G57000 AT3G57000.1 CTTAATGGGCCTATT nucleolar essential protein-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1252 Blast hits to 912 proteins in 202 species: Archae – 94; Bacteria – 9; Metazoa – 674; Fungi – 138; Plants – 36; Viruses – 2; Other Eukaryotes – 299 (source: NCBI BLink).&nbsp AT3G57440 AT3G57440.1 TAAATGGGCCATAAGGCC unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 17; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT3G57480 AT3G57480.1 TAAATGGGCCTGT zinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT2G41835.1); Has 368 Blast hits to 368 proteins in 124 species: Archae – 0; Bacteria – 0; Metazoa – 197; Fungi – 75; Plants – 47; Viruses – 0; Other Eukaryotes – 49 (source: NCBI BLink).&nbsp AT3G57890 AT3G57890.1 UNEAATGGGCCTCT tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae – 0; Bacteria – 0; Metazoa – 177; Fungi – 0; Plants – 51; Viruses – 0; Other Eukaryotes – 58 (source: NCBI BLink).&nbsp AT3G57930 AT3G57930.1 CTAATGGGCCAAAGCCCAAAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae – 0; Bacteria – 32; Metazoa – 833; Fungi – 105; Plants – 87; Viruses – 30; Other Eukaryotes – 578 (source: NCBI BLink).&nbsp AT3G57930.2 CTAATGGGCCAAAGCCCAAAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae – 0; Bacteria – 32; Metazoa – 833; Fungi – 105; Plants – 87; Viruses – 30; Other Eukaryotes – 578 (source: NCBI BLink).&nbsp AT3G57940 AT3G57940.1 GTTTGGGCTTTGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae – 82; Bacteria – 412; Metazoa – 163; Fungi – 92; Plants – 21; Viruses – 3; Other Eukaryotes – 142 (source: NCBI BLink).&nbsp AT3G58600 AT3G58600.1 AAAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae – 0; Bacteria – 0; Metazoa – 191; Fungi – 43; Plants – 52; Viruses – 0; Other Eukaryotes – 43 (source: NCBI BLink).&nbsp AT3G58600.1 ATAATGGGCCTAGGCCTATT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae – 0; Bacteria – 0; Metazoa – 191; Fungi – 43; Plants – 52; Viruses – 0; Other Eukaryotes – 43 (source: NCBI BLink).&nbsp AT3G58610 AT3G58610.1 AATAGGCCTAGGCCCATTAT ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae – 134; Bacteria – 2645; Metazoa – 0; Fungi – 179; Plants – 83; Viruses – 0; Other Eukaryotes – 2444 (source: NCBI BLink).&nbsp AT3G58610.1 TTAATGGGCCTTTT ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae – 134; Bacteria – 2645; Metazoa – 0; Fungi – 179; Plants – 83; Viruses – 0; Other Eukaryotes – 2444 (source: NCBI BLink).&nbsp AT3G58610.2 AATAGGCCTAGGCCCATTAT ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae – 134; Bacteria – 2645; Metazoa – 0; Fungi – 179; Plants – 83; Viruses – 0; Other Eukaryotes – 2444 (source: NCBI BLink).&nbsp AT3G58610.2 TTAATGGGCCTTTT ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae – 134; Bacteria – 2645; Metazoa – 0; Fungi – 179; Plants – 83; Viruses – 0; Other Eukaryotes – 2444 (source: NCBI BLink).&nbsp AT3G59540 AT3G59540.1 TTAATGGGCCTAAGGGGT 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae – 3; Bacteria – 0; Metazoa – 220; Fungi – 79; Plants – 70; Viruses – 0; Other Eukaryotes – 86 (source: NCBI BLink).&nbsp AT3G59990 AT3G59990.1 GTAAGGCCCATTAA Encodes a MAP2 like methionine aminopeptidase&nbsp AT3G59990.2 GTAAGGCCCATTAA Encodes a MAP2 like methionine aminopeptidase&nbsp AT3G59990.3 GTAAGGCCCATTAA Encodes a MAP2 like methionine aminopeptidase&nbsp AT3G60810 AT3G60810.1 CAATGGGCCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae – 0; Bacteria – 211; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 116 (source: NCBI BLink).&nbsp AT3G60810.2 CAATGGGCCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae – 0; Bacteria – 211; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 116 (source: NCBI BLink).&nbsp AT3G60820 AT3G60820.1 CAAAGCCCAAATAAGGCCCATTATAAAGCC Encodes 20S proteasome beta subunit PBF1 (PBF1).&nbsp AT3G60820.2 CAAAGCCCAAATAAGGCCCATTATAAAGCC Encodes 20S proteasome beta subunit PBF1 (PBF1).&nbsp AT3G61860 AT3G61860.1 AAGGCCCATTAT encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.&nbsp AT3G61870 AT3G61870.1 ATAATGGGCCTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae – 0; Bacteria – 85; Metazoa – 0; Fungi – 0; Plants – 20; Viruses – 0; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT3G61870.2 ATAATGGGCCTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae – 0; Bacteria – 85; Metazoa – 0; Fungi – 0; Plants – 20; Viruses – 0; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT3G62080 AT3G62080.1 TTAATGGGCCGGGCCTAAT SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae – 16; Bacteria – 52; Metazoa – 556; Fungi – 89; Plants – 91; Viruses – 1; Other Eukaryotes – 150 (source: NCBI BLink).&nbsp AT3G62080.1 TTAATGGGCCTGG SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae – 16; Bacteria – 52; Metazoa – 556; Fungi – 89; Plants – 91; Viruses – 1; Other Eukaryotes – 150 (source: NCBI BLink).&nbsp AT3G62680 AT3G62680.1 TTAATGGGCCTAT Proline-rich protein&nbsp AT3G62800 AT3G62800.1 ATAAGCCCAATTTTGGCCCATTAA Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.&nbsp AT3G62800.2 ATAAGCCCAATTTTGGCCCATTAA Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.&nbsp AT3G62800.3 ATAAGCCCAATTTTGGCCCATTAA Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.&nbsp AT3G62810 AT3G62810.1 TTAATGGGCCAAAATTGGGCTTAT complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae – 0; Bacteria – 0; Metazoa – 22; Fungi – 22; Plants – 17; Viruses – 0; Other Eukaryotes – 7 (source: NCBI BLink).&nbsp AT3G63140 AT3G63140.1 TAAATGGGCCCATTT Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation.&nbsp AT3G63190 AT3G63190.1 TACGGCCCATTAAGGCCCACA RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR (RRF); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response to bacterium, translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: ribosome recycling factor family protein / ribosome releasing factor family protein (TAIR:AT3G01800.1); Has 5492 Blast hits to 5492 proteins in 1475 species: Archae – 0; Bacteria – 2924; Metazoa – 104; Fungi – 52; Plants – 56; Viruses – 0; Other Eukaryotes – 2356 (source: NCBI BLink).&nbsp AT4G00500 AT4G00500.1 TTAATGGGCCTATA lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae – 0; Bacteria – 0; Metazoa – 145; Fungi – 42; Plants – 130; Viruses – 0; Other Eukaryotes – 59 (source: NCBI BLink).&nbsp AT4G00500.2 TTAATGGGCCTATA lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae – 0; Bacteria – 0; Metazoa – 145; Fungi – 42; Plants – 130; Viruses – 0; Other Eukaryotes – 59 (source: NCBI BLink).&nbsp AT4G00520 AT4G00520.2 TATAGGCCCATTAA acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae – 0; Bacteria – 1072; Metazoa – 364; Fungi – 190; Plants – 32; Viruses – 0; Other Eukaryotes – 751 (source: NCBI BLink).&nbsp AT4G00520.3 TATAGGCCCATTAA acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae – 0; Bacteria – 1072; Metazoa – 364; Fungi – 190; Plants – 32; Viruses – 0; Other Eukaryotes – 751 (source: NCBI BLink).&nbsp AT4G00585 AT4G00585.1 TAAATGGGCCTTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae – 0; Bacteria – 0; Metazoa – 2; Fungi – 6; Plants – 20; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT4G00590 AT4G00590.1 TTAAGGCCCATTTA asparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae – 71; Bacteria – 869; Metazoa – 420; Fungi – 151; Plants – 90; Viruses – 0; Other Eukaryotes – 561 (source: NCBI BLink).&nbsp AT4G00810 AT4G00810.1 CAATGGGCCTTT 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae – 60; Bacteria – 0; Metazoa – 672; Fungi – 360; Plants – 316; Viruses – 0; Other Eukaryotes – 265 (source: NCBI BLink).&nbsp AT4G00810.2 CAATGGGCCTTT 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae – 60; Bacteria – 0; Metazoa – 672; Fungi – 360; Plants – 316; Viruses – 0; Other Eukaryotes – 265 (source: NCBI BLink).&nbsp AT4G00840 AT4G00840.1 TTATTGGGCCTGTTAATGGGCCTTAT zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae – 0; Bacteria – 0; Metazoa – 1955; Fungi – 533; Plants – 396; Viruses – 0; Other Eukaryotes – 1108 (source: NCBI BLink).&nbsp AT4G00850 AT4G00850.1 ATAAGGCCCATTAACAGGCCCAATAA Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA&nbsp AT4G00860 AT4G00860.1 UNEAATGGGCCCATAATGGCCCAATAT putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains.&nbsp AT4G00895 AT4G00895.1 ATTAGGCCCATTTA ATP synthase delta chain-related; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: proton-transporting ATP synthase complex, catalytic core F(1), chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 40 Blast hits to 40 proteins in 15 species: Archae – 0; Bacteria – 0; Metazoa – 6; Fungi – 11; Plants – 20; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT4G01560 AT4G01560.1 ATAGGCCCATTT maternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae – 2; Bacteria – 0; Metazoa – 218; Fungi – 225; Plants – 59; Viruses – 0; Other Eukaryotes – 132 (source: NCBI BLink).&nbsp AT4G01570 AT4G01570.1 UNEAATGGGCCTAT pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae – 8; Bacteria – 10; Metazoa – 231; Fungi – 283; Plants – 23698; Viruses – 0; Other Eukaryotes – 993 (source: NCBI BLink).&nbsp AT4G01590 AT4G01590.1 ACTGGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae – 0; Bacteria – 99; Metazoa – 666; Fungi – 320; Plants – 99; Viruses – 74; Other Eukaryotes – 776 (source: NCBI BLink).&nbsp AT4G01590.2 ACTGGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae – 0; Bacteria – 99; Metazoa – 666; Fungi – 320; Plants – 99; Viruses – 74; Other Eukaryotes – 776 (source: NCBI BLink).&nbsp AT4G01660 AT4G01660.1 AGCCCAATGGGCCTTAT Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant&nbsp AT4G01940 AT4G01940.1 ATCGGCCCATTT Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast.&nbsp AT4G02195 AT4G02195.1 TAAATGGGCCTAAAAAGGCCCAAAT member of SYP4 Gene Family&nbsp AT4G02550 AT4G02550.1 TCGGCCCATTg unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 9; Plants – 196; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G02550.2 TCGGCCCATTg unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 9; Plants – 196; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G02550.3 TCGGCCCATTg unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 9; Plants – 196; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G02580 AT4G02580.1 UNEAATGGGCCTTTAA NADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae – 12; Bacteria – 1956; Metazoa – 160; Fungi – 76; Plants – 28; Viruses – 0; Other Eukaryotes – 1771 (source: NCBI BLink).&nbsp AT4G03260 AT4G03260.1 GTAAGGCCCATTTA leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae – 12; Bacteria – 2927; Metazoa – 5462; Fungi – 520; Plants – 576; Viruses – 25; Other Eukaryotes – 1130 (source: NCBI BLink).&nbsp AT4G03260.2 GTAAGGCCCATTTA leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae – 12; Bacteria – 2927; Metazoa – 5462; Fungi – 520; Plants – 576; Viruses – 25; Other Eukaryotes – 1130 (source: NCBI BLink).&nbsp AT4G07950 AT4G07950.1 UNEAATGGGCCTTAA DNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT1G01210.1); Has 795 Blast hits to 795 proteins in 228 species: Archae – 146; Bacteria – 0; Metazoa – 234; Fungi – 176; Plants – 62; Viruses – 0; Other Eukaryotes – 177 (source: NCBI BLink).&nbsp AT4G09730 AT4G09730.1 CTTAATGGGCCAA DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae – 427; Bacteria – 10484; Metazoa – 4922; Fungi – 3195; Plants – 1331; Viruses – 9; Other Eukaryotes – 6246 (source: NCBI BLink).&nbsp AT4G10180 AT4G10180.1 TCAGGCCCATTAA Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling.&nbsp AT4G10250 AT4G10250.1 ATAATGGGCCAAT Columbia endomembrane-localized small heat shock protein&nbsp AT4G10320 AT4G10320.1 TACGGCCCATTAA isoleucyl-tRNA synthetase, putative / isoleucine–tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae – 699; Bacteria – 11987; Metazoa – 692; Fungi – 480; Plants – 135; Viruses – 0; Other Eukaryotes – 13655 (source: NCBI BLink).&nbsp AT4G10480 AT4G10480.1 CTAAGGCCCATTAA nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae – 53; Bacteria – 5; Metazoa – 324; Fungi – 191; Plants – 110; Viruses – 2; Other Eukaryotes – 183 (source: NCBI BLink).&nbsp AT4G10480.2 CTAAGGCCCATTAA nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae – 53; Bacteria – 5; Metazoa – 324; Fungi – 191; Plants – 110; Viruses – 2; Other Eukaryotes – 183 (source: NCBI BLink).&nbsp AT4G10710 AT4G10710.1 TAAATGGGCCAC encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.&nbsp AT4G11120 AT4G11120.1 CTTAATGGGCCAT translation elongation factor Ts (EF-Ts), putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Translation elongation factor Ts, conserved site (InterPro:IPR018101), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), UBA-like (InterPro:IPR009060), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039); BEST Arabidopsis thaliana protein match is: emb2726 (embryo defective 2726); RNA binding / translation elongation factor (TAIR:AT4G29060.1); Has 6692 Blast hits to 6063 proteins in 1504 species: Archae – 0; Bacteria – 3293; Metazoa – 104; Fungi – 16; Plants – 114; Viruses – 0; Other Eukaryotes – 3165 (source: NCBI BLink).&nbsp AT4G13720 AT4G13720.1 CAATGGGCCTAAA inosine triphosphate pyrophosphatase, putative / HAM1 family protein; FUNCTIONS IN: hydrolase activity, pyrophosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ham1-like protein (InterPro:IPR002637); Has 4493 Blast hits to 4493 proteins in 1469 species: Archae – 141; Bacteria – 2387; Metazoa – 137; Fungi – 111; Plants – 30; Viruses – 1; Other Eukaryotes – 1686 (source: NCBI BLink).&nbsp AT4G14110 AT4G14110.1 TAGTGGGCTTGGCCCATTTA Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex.&nbsp AT4G14145 AT4G14145.1 TACTGGGCTGGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 16; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G14490 AT4G14490.1 TAAAAGCCCATTTAAGGCCCATTAA forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae – 14; Bacteria – 671; Metazoa – 68; Fungi – 54; Plants – 81; Viruses – 0; Other Eukaryotes – 187 (source: NCBI BLink).&nbsp AT4G14615 AT4G14615.1 ATTGGCCCATTC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 29; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G14905 AT4G14905.1 AAATGGGCTTTATAGGCCCATTT kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae – 0; Bacteria – 13; Metazoa – 536; Fungi – 5; Plants – 603; Viruses – 14; Other Eukaryotes – 38 (source: NCBI BLink).&nbsp AT4G14905.2 AAATGGGCTTTATAGGCCCATTT kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae – 0; Bacteria – 13; Metazoa – 536; Fungi – 5; Plants – 603; Viruses – 14; Other Eukaryotes – 38 (source: NCBI BLink).&nbsp AT4G15240 AT4G15240.1 TTAATGGGCCGA fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae – 0; Bacteria – 0; Metazoa – 123; Fungi – 109; Plants – 125; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT4G15260 AT4G15260.1 TAAATGGGCCUNE UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B5 (UDP-GLUCOSYL TRANSFERASE 71B5); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT4G15280.1); Has 4447 Blast hits to 4433 proteins in 286 species: Archae – 0; Bacteria – 156; Metazoa – 1629; Fungi – 12; Plants – 2597; Viruses – 18; Other Eukaryotes – 35 (source: NCBI BLink).&nbsp AT4G15410 AT4G15410.1 TTTGGGCCCATTAA Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae – 0; Bacteria – 87; Metazoa – 456; Fungi – 202; Plants – 88; Viruses – 16; Other Eukaryotes – 1320 (source: NCBI BLink).&nbsp AT4G15930 AT4G15930.1 ATAATGGGCCTGA microtubule motor; FUNCTIONS IN: microtubule motor activity; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynein light chain, type 1 and 2 (InterPro:IPR001372); BEST Arabidopsis thaliana protein match is: dynein light chain, putative (TAIR:AT5G20110.1); Has 980 Blast hits to 980 proteins in 172 species: Archae – 0; Bacteria – 0; Metazoa – 538; Fungi – 74; Plants – 124; Viruses – 0; Other Eukaryotes – 244 (source: NCBI BLink).&nbsp AT4G16500 AT4G16500.1 TATATGGGCCCATTTA cysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae – 0; Bacteria – 0; Metazoa – 4; Fungi – 0; Plants – 452; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT4G16695 AT4G16695.1 AGAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16695.1 CAAAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16695.2 AGAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16695.2 CAAAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16695.3 AGAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16695.3 CAAAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G16970 AT4G16970.1 UNEAATGGGCCTGT ATP binding / kinase/ protein kinase/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: casein kinase II alpha chain, putative (TAIR:AT2G23070.1); Has 28325 Blast hits to 23063 proteins in 766 species: Archae – 4; Bacteria – 1025; Metazoa – 12500; Fungi – 3604; Plants – 4846; Viruses – 36; Other Eukaryotes – 6310 (source: NCBI BLink).&nbsp AT4G17020 AT4G17020.1 ATAGGCCCATTAG transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae – 0; Bacteria – 0; Metazoa – 131; Fungi – 97; Plants – 31; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT4G17020.1 CAAGGCCCATTAA transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae – 0; Bacteria – 0; Metazoa – 131; Fungi – 97; Plants – 31; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT4G17020.2 ATAGGCCCATTAG transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae – 0; Bacteria – 0; Metazoa – 131; Fungi – 97; Plants – 31; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT4G17020.2 CAAGGCCCATTAA transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae – 0; Bacteria – 0; Metazoa – 131; Fungi – 97; Plants – 31; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT4G17190 AT4G17190.1 TAAATGGGCCACAAAAAGCCCATTTA Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers.&nbsp AT4G17190.2 TAAATGGGCCACAAAAAGCCCATTTA Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers.&nbsp AT4G17390 AT4G17390.1 ATAATGGGCCATA 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae – 217; Bacteria – 0; Metazoa – 330; Fungi – 103; Plants – 125; Viruses – 0; Other Eukaryotes – 196 (source: NCBI BLink).&nbsp AT4G17410 AT4G17410.1 TATGGCCCATTAT zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae – 2; Bacteria – 71; Metazoa – 5540; Fungi – 1215; Plants – 632; Viruses – 56; Other Eukaryotes – 1215 (source: NCBI BLink).&nbsp AT4G17530 AT4G17530.1 ATTAGGCCCATTAT ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae – 17; Bacteria – 111; Metazoa – 13220; Fungi – 2827; Plants – 2160; Viruses – 19; Other Eukaryotes – 5239 (source: NCBI BLink).&nbsp AT4G17530.1 TTAATGGGCCTTAG ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae – 17; Bacteria – 111; Metazoa – 13220; Fungi – 2827; Plants – 2160; Viruses – 19; Other Eukaryotes – 5239 (source: NCBI BLink).&nbsp AT4G17540 AT4G17540.1 ATAATGGGCCTAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae – 4; Bacteria – 22; Metazoa – 9; Fungi – 3; Plants – 32; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT4G17540.1 CTAAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae – 4; Bacteria – 22; Metazoa – 9; Fungi – 3; Plants – 32; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT4G17620 AT4G17620.1 UNEAATGGGCCTTTAA glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae – 96; Bacteria – 22048; Metazoa – 7737; Fungi – 2748; Plants – 703; Viruses – 217; Other Eukaryotes – 9189 (source: NCBI BLink).&nbsp AT4G17620.2 UNEAATGGGCCTTTAA glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae – 96; Bacteria – 22048; Metazoa – 7737; Fungi – 2748; Plants – 703; Viruses – 217; Other Eukaryotes – 9189 (source: NCBI BLink).&nbsp AT4G17840 AT4G17840.1 TATGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae – 0; Bacteria – 24; Metazoa – 708; Fungi – 70; Plants – 25; Viruses – 2; Other Eukaryotes – 1076 (source: NCBI BLink).&nbsp AT4G18975 AT4G18975.1 AAAAGGCCCATTAA pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 60; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G18975.2 AAAAGGCCCATTAA pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 60; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G18975.3 AAAAGGCCCATTAA pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 60; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G19130 AT4G19130.1 UNEAATGGGCCTATA DNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae – 16; Bacteria – 0; Metazoa – 189; Fungi – 98; Plants – 176; Viruses – 0; Other Eukaryotes – 130 (source: NCBI BLink).&nbsp AT4G19140 AT4G19140.1 TATAGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 15; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G19350 AT4G19350.1 TAATGGGCCGT embryo defective 3006 (EMB3006); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 3; Fungi – 2; Plants – 17; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G19710 AT4G19710.1 TAAATGGGCCAA Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.&nbsp AT4G19710.2 TAAATGGGCCAA Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.&nbsp AT4G20300 AT4G20300.1 TAGTGGGCCTGATAATGGGCCGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae – 0; Bacteria – 7; Metazoa – 184; Fungi – 40; Plants – 150; Viruses – 0; Other Eukaryotes – 75 (source: NCBI BLink).&nbsp AT4G20300.2 TAGTGGGCCTGATAATGGGCCGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae – 0; Bacteria – 7; Metazoa – 184; Fungi – 40; Plants – 150; Viruses – 0; Other Eukaryotes – 75 (source: NCBI BLink).&nbsp AT4G20480 AT4G20480.1 GTAGGCCCATTAA unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06810.1); Has 76 Blast hits to 74 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 76; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G21190 AT4G21190.1 TTAATGGGCCTATT embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae – 0; Bacteria – 2; Metazoa – 6; Fungi – 0; Plants – 126; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT4G21190.1 TTAATGGGCCTATT embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae – 0; Bacteria – 2; Metazoa – 6; Fungi – 0; Plants – 126; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT4G21190.1 TTAATGGGCCTTAT embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae – 0; Bacteria – 2; Metazoa – 6; Fungi – 0; Plants – 126; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT4G21192 AT4G21192.1 AATAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G21192.1 AATAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G21192.1 ATAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G21192.2 AATAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G21192.2 AATAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G21192.2 ATAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae – 0; Bacteria – 0; Metazoa – 71; Fungi – 29; Plants – 9; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G22240 AT4G22240.1 GAGGCCCATTTA plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae – 0; Bacteria – 66; Metazoa – 0; Fungi – 0; Plants – 219; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT4G22720 AT4G22720.1 TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae – 187; Bacteria – 2972; Metazoa – 216; Fungi – 190; Plants – 122; Viruses – 0; Other Eukaryotes – 3067 (source: NCBI BLink).&nbsp AT4G22720.2 TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae – 187; Bacteria – 2972; Metazoa – 216; Fungi – 190; Plants – 122; Viruses – 0; Other Eukaryotes – 3067 (source: NCBI BLink).&nbsp AT4G23420 AT4G23420.1 CGGCCCATTC short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae – 235; Bacteria – 21258; Metazoa – 3640; Fungi – 2170; Plants – 961; Viruses – 0; Other Eukaryotes – 8256 (source: NCBI BLink).&nbsp AT4G23420.2 CGGCCCATTC short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae – 235; Bacteria – 21258; Metazoa – 3640; Fungi – 2170; Plants – 961; Viruses – 0; Other Eukaryotes – 8256 (source: NCBI BLink).&nbsp AT4G23710 AT4G23710.1 TTAATGGGCCTGA VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae – 0; Bacteria – 2; Metazoa – 268; Fungi – 80; Plants – 75; Viruses – 0; Other Eukaryotes – 45 (source: NCBI BLink).&nbsp AT4G24290 AT4G24290.1 CAATGGGCCCACA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae – 0; Bacteria – 0; Metazoa – 41; Fungi – 0; Plants – 104; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT4G24290.2 CAATGGGCCCACA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae – 0; Bacteria – 0; Metazoa – 41; Fungi – 0; Plants – 104; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT4G24500 AT4G24500.1 TTAATGGGCCGGTTTAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae – 0; Bacteria – 10; Metazoa – 159; Fungi – 48; Plants – 40; Viruses – 3; Other Eukaryotes – 25 (source: NCBI BLink).&nbsp AT4G24500.2 TTAATGGGCCGGTTTAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae – 0; Bacteria – 10; Metazoa – 159; Fungi – 48; Plants – 40; Viruses – 3; Other Eukaryotes – 25 (source: NCBI BLink).&nbsp AT4G24690 AT4G24690.1 AGGGCCCATTAA ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Zinc finger, ZZ-type (InterPro:IPR000433); Has 492 Blast hits to 472 proteins in 101 species: Archae – 0; Bacteria – 6; Metazoa – 329; Fungi – 68; Plants – 57; Viruses – 0; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT4G25550 AT4G25550.1 TAAATGGGCCGG protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae – 0; Bacteria – 0; Metazoa – 138; Fungi – 53; Plants – 42; Viruses – 0; Other Eukaryotes – 58 (source: NCBI BLink).&nbsp AT4G25550.1 TAAATGGGCCTAAA protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae – 0; Bacteria – 0; Metazoa – 138; Fungi – 53; Plants – 42; Viruses – 0; Other Eukaryotes – 58 (source: NCBI BLink).&nbsp AT4G25570 AT4G25570.1 ATAATGGGCCTTAA Encodes cytochrome b561.&nbsp AT4G25890 AT4G25890.1 GTGGCCCATTTA 60S acidic ribosomal protein P3 (RPP3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3B) (TAIR:AT5G57290.2); Has 578 Blast hits to 577 proteins in 136 species: Archae – 0; Bacteria – 6; Metazoa – 262; Fungi – 76; Plants – 177; Viruses – 0; Other Eukaryotes – 57 (source: NCBI BLink).&nbsp AT4G26190 AT4G26190.1 TAAATGGGCCAC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36550.1); Has 24148 Blast hits to 14674 proteins in 713 species: Archae – 56; Bacteria – 1518; Metazoa – 9576; Fungi – 1916; Plants – 955; Viruses – 87; Other Eukaryotes – 10040 (source: NCBI BLink).&nbsp AT4G26310 AT4G26310.1 TTAAGGCCCATTAT elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae – 6; Bacteria – 4287; Metazoa – 0; Fungi – 0; Plants – 40; Viruses – 0; Other Eukaryotes – 2373 (source: NCBI BLink).&nbsp AT4G26600 AT4G26600.1 TCAGGCCCATTAG nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae – 305; Bacteria – 24540; Metazoa – 13109; Fungi – 5777; Plants – 1987; Viruses – 583; Other Eukaryotes – 12174 (source: NCBI BLink).&nbsp AT4G26720 AT4G26720.1 TCTGGGCCCATTAT Encodes catalytic subunit of protein phosphatase X. Expressed at very low levels in A. thaliana flowers, leaves, stems and roots.&nbsp AT4G26990 AT4G26990.1 ATAAGGGCCCATTAAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae – 0; Bacteria – 4; Metazoa – 71; Fungi – 20; Plants – 57; Viruses – 0; Other Eukaryotes – 24 (source: NCBI BLink).&nbsp AT4G27000 AT4G27000.1 ATAATGGGCCGA ATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae – 10; Bacteria – 1237; Metazoa – 14401; Fungi – 2729; Plants – 3582; Viruses – 5; Other Eukaryotes – 2102 (source: NCBI BLink).&nbsp AT4G27320 AT4G27320.1 ACGGCCCATTAT Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase.&nbsp AT4G27370 AT4G27370.1 TAAAGGCCCATTTA member of Myosin-like proteins&nbsp AT4G27380 AT4G27380.1 TAAATGGGCCTTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae – 0; Bacteria – 7; Metazoa – 0; Fungi – 0; Plants – 17; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G27740 AT4G27740.1 UNEAATGGGCCTTTA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae – 0; Bacteria – 0; Metazoa – 389; Fungi – 132; Plants – 111; Viruses – 0; Other Eukaryotes – 52 (source: NCBI BLink).&nbsp AT4G27740.1 ATGGCCCATTAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae – 0; Bacteria – 0; Metazoa – 389; Fungi – 132; Plants – 111; Viruses – 0; Other Eukaryotes – 52 (source: NCBI BLink).&nbsp AT4G28010 AT4G28010.1 TTGGCCCATTC pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae – 5; Bacteria – 29; Metazoa – 747; Fungi – 685; Plants – 24892; Viruses – 0; Other Eukaryotes – 1355 (source: NCBI BLink).&nbsp AT4G28060 AT4G28060.1 CTTAGGCCCATTAG cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae – 0; Bacteria – 0; Metazoa – 235; Fungi – 77; Plants – 83; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT4G28230 AT4G28230.1 GGGCTATTTGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae – 0; Bacteria – 7; Metazoa – 168; Fungi – 23; Plants – 22; Viruses – 2; Other Eukaryotes – 163 (source: NCBI BLink).&nbsp AT4G28540 AT4G28540.1 GTTAGGCCCATTTA CASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae – 12; Bacteria – 5612; Metazoa – 19980; Fungi – 4668; Plants – 5911; Viruses – 338; Other Eukaryotes – 9579 (source: NCBI BLink).&nbsp AT4G28730 AT4G28730.1 TATAGGCCCATTAAG glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae – 0; Bacteria – 1253; Metazoa – 362; Fungi – 221; Plants – 386; Viruses – 107; Other Eukaryotes – 817 (source: NCBI BLink).&nbsp AT4G28830 AT4G28830.1 AAAGCCCAATGGGCCTGA methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae – 135; Bacteria – 1556; Metazoa – 106; Fungi – 2; Plants – 24; Viruses – 0; Other Eukaryotes – 229 (source: NCBI BLink).&nbsp AT4G28830.2 AAAGCCCAATGGGCCTGA methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae – 135; Bacteria – 1556; Metazoa – 106; Fungi – 2; Plants – 24; Viruses – 0; Other Eukaryotes – 229 (source: NCBI BLink).&nbsp AT4G29070 AT4G29070.1 TCGGCCCATTTTGAGCCCAATAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G29070.2 TCGGCCCATTTTGAGCCCAATAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G29390 AT4G29390.1 CTAATGGGCCGTA 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae – 2; Bacteria – 0; Metazoa – 223; Fungi – 90; Plants – 56; Viruses – 1; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT4G29390.1 TATAGGCCCATTAAG 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae – 2; Bacteria – 0; Metazoa – 223; Fungi – 90; Plants – 56; Viruses – 1; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT4G29400 AT4G29400.1 CTTAATGGGCCTATA unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae – 0; Bacteria – 100; Metazoa – 0; Fungi – 0; Plants – 33; Viruses – 0; Other Eukaryotes – 126 (source: NCBI BLink).&nbsp AT4G29400.1 TACGGCCCATTAG unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae – 0; Bacteria – 100; Metazoa – 0; Fungi – 0; Plants – 33; Viruses – 0; Other Eukaryotes – 126 (source: NCBI BLink).&nbsp AT4G29520 AT4G29520.1 TTAATGGGCCTTAC LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae – 2; Bacteria – 0; Metazoa – 42; Fungi – 10; Plants – 19; Viruses – 0; Other Eukaryotes – 47 (source: NCBI BLink).&nbsp AT4G29520.1 TTGGCCCATTT LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae – 2; Bacteria – 0; Metazoa – 42; Fungi – 10; Plants – 19; Viruses – 0; Other Eukaryotes – 47 (source: NCBI BLink).&nbsp AT4G29530 AT4G29530.1 UNEAATGGGCCAA 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae – 0; Bacteria – 19; Metazoa – 155; Fungi – 12; Plants – 57; Viruses – 0; Other Eukaryotes – 26 (source: NCBI BLink).&nbsp AT4G29530.1 GTAAGGCCCATTAA 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae – 0; Bacteria – 19; Metazoa – 155; Fungi – 12; Plants – 57; Viruses – 0; Other Eukaryotes – 26 (source: NCBI BLink).&nbsp AT4G29820 AT4G29820.1 ACAGGCCCATTUNE Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit.&nbsp AT4G29820.1 TAAAGGCCCATTAA Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit.&nbsp AT4G29830 AT4G29830.1 TTAATGGGCCTGT The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.&nbsp AT4G29830.1 TTAATGGGCCTTTA The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.&nbsp AT4G29840 AT4G29840.1 TTAATGGGCCCAAAA threonine synthase&nbsp AT4G30220 AT4G30220.1 ATAATGGGCCTTAT SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae – 256; Bacteria – 0; Metazoa – 220; Fungi – 185; Plants – 64; Viruses – 0; Other Eukaryotes – 140 (source: NCBI BLink).&nbsp AT4G30220.1 CAGGCCCATTAT SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae – 256; Bacteria – 0; Metazoa – 220; Fungi – 185; Plants – 64; Viruses – 0; Other Eukaryotes – 140 (source: NCBI BLink).&nbsp AT4G30480 AT4G30480.1 CTTAATGGGCCAAT tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae – 360; Bacteria – 1926; Metazoa – 3500; Fungi – 950; Plants – 1004; Viruses – 24; Other Eukaryotes – 2730 (source: NCBI BLink).&nbsp AT4G30480.2 CTTAATGGGCCAAT tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae – 360; Bacteria – 1926; Metazoa – 3500; Fungi – 950; Plants – 1004; Viruses – 24; Other Eukaryotes – 2730 (source: NCBI BLink).&nbsp AT4G30480.3 CTTAATGGGCCAAT tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae – 360; Bacteria – 1926; Metazoa – 3500; Fungi – 950; Plants – 1004; Viruses – 24; Other Eukaryotes – 2730 (source: NCBI BLink).&nbsp AT4G30500 AT4G30500.1 TGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae – 0; Bacteria – 0; Metazoa – 85; Fungi – 72; Plants – 29; Viruses – 0; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT4G30580 AT4G30580.1 UNEAATGGGCCAT Encodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal.&nbsp AT4G30660 AT4G30660.1 CCAGGCCCATTTA hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae – 0; Bacteria – 358; Metazoa – 42; Fungi – 194; Plants – 182; Viruses – 0; Other Eukaryotes – 16 (source: NCBI BLink).&nbsp AT4G30660.2 CCAGGCCCATTTA hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae – 0; Bacteria – 358; Metazoa – 42; Fungi – 194; Plants – 182; Viruses – 0; Other Eukaryotes – 16 (source: NCBI BLink).&nbsp AT4G31010 AT4G31010.1 CTAATGGGCCCTA RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 165; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G31010.2 CTAATGGGCCCTA RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 165; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G31150 AT4G31150.1 ATAATGGGCCTTTTAAAGGCCC endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae – 97; Bacteria – 529; Metazoa – 66; Fungi – 5; Plants – 17; Viruses – 0; Other Eukaryotes – 77 (source: NCBI BLink).&nbsp AT4G31150.2 ATAATGGGCCTTTTAAAGGCCC endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae – 97; Bacteria – 529; Metazoa – 66; Fungi – 5; Plants – 17; Viruses – 0; Other Eukaryotes – 77 (source: NCBI BLink).&nbsp AT4G31420 AT4G31420.1 gAATGGGCCAAATGGGCTA zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae – 0; Bacteria – 0; Metazoa – 207; Fungi – 160; Plants – 53; Viruses – 0; Other Eukaryotes – 83 (source: NCBI BLink).&nbsp AT4G31420.2 gAATGGGCCAAATGGGCTA zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae – 0; Bacteria – 0; Metazoa – 207; Fungi – 160; Plants – 53; Viruses – 0; Other Eukaryotes – 83 (source: NCBI BLink).&nbsp AT4G31560 AT4G31560.1 TTAATGGGCCTC Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.&nbsp AT4G32820 AT4G32820.1 AATAGGCCCATTAA binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).&nbsp AT4G32820.2 AATAGGCCCATTAA binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).&nbsp AT4G34700 AT4G34700.1 CAAAGGCCCATTT complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae – 0; Bacteria – 0; Metazoa – 85; Fungi – 51; Plants – 24; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT4G34700.1 TTAATGGGCCGAT complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae – 0; Bacteria – 0; Metazoa – 85; Fungi – 51; Plants – 24; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT4G34710 AT4G34710.1 TAAATGGGCCC encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.&nbsp AT4G34710.2 TAAATGGGCCC encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.&nbsp AT4G34960 AT4G34960.1 ATGGCCCATTAG peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae – 82; Bacteria – 3582; Metazoa – 2365; Fungi – 952; Plants – 729; Viruses – 4; Other Eukaryotes – 3516 (source: NCBI BLink).&nbsp AT4G35140 AT4G35140.1 TAAATGGGCCAA transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae – 10; Bacteria – 1449; Metazoa – 3242; Fungi – 1387; Plants – 483; Viruses – 0; Other Eukaryotes – 1167 (source: NCBI BLink).&nbsp AT4G36280 AT4G36280.1 UNEAATGGGCCTATA ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae – 0; Bacteria – 16; Metazoa – 167; Fungi – 0; Plants – 91; Viruses – 0; Other Eukaryotes – 32 (source: NCBI BLink).&nbsp AT4G36420 AT4G36420.1 ATAGGCCCATAAAGGCCCATTT ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5784 Blast hits to 5784 proteins in 1564 species: Archae – 0; Bacteria – 3201; Metazoa – 134; Fungi – 85; Plants – 177; Viruses – 0; Other Eukaryotes – 2187 (source: NCBI BLink).&nbsp AT4G36690 AT4G36690.1 ATAATGGGCCTTAT ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae – 55; Bacteria – 3616; Metazoa – 33617; Fungi – 6101; Plants – 4473; Viruses – 271; Other Eukaryotes – 10501 (source: NCBI BLink).&nbsp AT4G36690.2 ATAATGGGCCTTAT ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae – 55; Bacteria – 3616; Metazoa – 33617; Fungi – 6101; Plants – 4473; Viruses – 271; Other Eukaryotes – 10501 (source: NCBI BLink).&nbsp AT4G36690.3 ATAATGGGCCTTAT ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae – 55; Bacteria – 3616; Metazoa – 33617; Fungi – 6101; Plants – 4473; Viruses – 271; Other Eukaryotes – 10501 (source: NCBI BLink).&nbsp AT4G36800 AT4G36800.1 UNEAATGGGCCTAACGGGCTTTAATGGGCCAA RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.&nbsp AT4G36800.2 UNEAATGGGCCTAACGGGCTTTAATGGGCCAA RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.&nbsp AT4G36810 AT4G36810.1 CAAGGCCCATTC Encodes a protein with geranylgeranyl pyrophosphate synthase activity involved in isoprenoid biosynthesis. The enzyme appears to be targeted to the chloroplast in epidermal cells and guard cells of leaves, and in etioplasts in roots.&nbsp AT4G37040 AT4G37040.1 TTGGCCCATTAATAGCCCAATAT encodes a methionine aminopeptidase&nbsp AT4G37440 AT4G37440.1 GTGGCCCATTT unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae – 0; Bacteria – 5; Metazoa – 46; Fungi – 9; Plants – 44; Viruses – 3; Other Eukaryotes – 59 (source: NCBI BLink).&nbsp AT4G37440.2 GTGGCCCATTT unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae – 0; Bacteria – 5; Metazoa – 46; Fungi – 9; Plants – 44; Viruses – 3; Other Eukaryotes – 59 (source: NCBI BLink).&nbsp AT4G37830 AT4G37830.1 TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 0; Plants – 29; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT4G37830.2 TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae – 0; Bacteria – 0; Metazoa – 100; Fungi – 0; Plants – 29; Viruses – 0; Other Eukaryotes – 9 (source: NCBI BLink).&nbsp AT4G38180 AT4G38180.1 gAATGGGCCTTAT FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae – 2; Bacteria – 0; Metazoa – 1; Fungi – 125; Plants – 879; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G38180.1 gAATGGGCCTTG FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae – 2; Bacteria – 0; Metazoa – 1; Fungi – 125; Plants – 879; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT4G38210 AT4G38210.1 AGGGCCCATTg expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.&nbsp AT4G38225 AT4G38225.1 ATTAGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 26; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G38225.2 ATTAGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 26; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G38225.3 ATTAGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 26; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G38280 AT4G38280.1 ATAATGGGCCTTAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 2; Plants – 41; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT4G38380 AT4G38380.1 AAAAGGCCCATTTA antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae – 174; Bacteria – 5061; Metazoa – 70; Fungi – 101; Plants – 194; Viruses – 0; Other Eukaryotes – 1671 (source: NCBI BLink).&nbsp AT4G38890 AT4G38890.1 TTATGGGCCGGTTTTTGGCCCATTAA dihydrouridine synthase family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7322 Blast hits to 7247 proteins in 1396 species: Archae – 11; Bacteria – 4174; Metazoa – 431; Fungi – 362; Plants – 91; Viruses – 0; Other Eukaryotes – 2253 (source: NCBI BLink).&nbsp AT4G39210 AT4G39210.1 UNEAATGGGCCTGG Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots.&nbsp AT4G39460 AT4G39460.1 TATAGGCCCATTAG Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway.&nbsp AT4G39550 AT4G39550.1 TGAGGCCCATTg kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae – 6; Bacteria – 90; Metazoa – 1470; Fungi – 6; Plants – 681; Viruses – 3; Other Eukaryotes – 78 (source: NCBI BLink).&nbsp AT4G39560 AT4G39560.1 TGAGGCCCATTAAG kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae – 4; Bacteria – 110; Metazoa – 1739; Fungi – 7; Plants – 628; Viruses – 37; Other Eukaryotes – 83 (source: NCBI BLink).&nbsp AT4G39560.2 TGAGGCCCATTAAG kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae – 4; Bacteria – 110; Metazoa – 1739; Fungi – 7; Plants – 628; Viruses – 37; Other Eukaryotes – 83 (source: NCBI BLink).&nbsp AT4G39880 AT4G39880.1 TTCGGCCCATTAAGGCCCATTAA ribosomal protein L23 family protein; FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L23/L15e, core (InterPro:IPR012678), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal protein L25/L23 (InterPro:IPR013025); Has 2011 Blast hits to 2011 proteins in 690 species: Archae – 0; Bacteria – 1392; Metazoa – 5; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 592 (source: NCBI BLink).&nbsp AT4G40042 AT4G40042.1 ATAAGGCCCATTg peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae – 0; Bacteria – 0; Metazoa – 103; Fungi – 56; Plants – 39; Viruses – 0; Other Eukaryotes – 20 (source: NCBI BLink).&nbsp AT5G01020 AT5G01020.1 ATAATGGGCCTAG protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae – 48; Bacteria – 7829; Metazoa – 37401; Fungi – 6493; Plants – 18635; Viruses – 347; Other Eukaryotes – 14177 (source: NCBI BLink).&nbsp AT5G01400 AT5G01400.1 AATAGGCCCACATCGGCCCATTAT Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64.&nbsp AT5G01650 AT5G01650.1 TTAAGGCCCATTT macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).&nbsp AT5G01650.2 TTAAGGCCCATTT macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).&nbsp AT5G02050 AT5G02050.1 TATGGCCCATTAAGTAATTGGGCCTTAT mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae – 0; Bacteria – 2; Metazoa – 39; Fungi – 94; Plants – 115; Viruses – 0; Other Eukaryotes – 79 (source: NCBI BLink).&nbsp AT5G02370 AT5G02370.1 TAAATGGGCCCAAAAAAGGCC kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae – 0; Bacteria – 21; Metazoa – 3823; Fungi – 875; Plants – 885; Viruses – 0; Other Eukaryotes – 1884 (source: NCBI BLink).&nbsp AT5G02470 AT5G02470.1 AAAAGGCCCATTTA core cell cycle genes&nbsp AT5G02470.2 AAAAGGCCCATTTA core cell cycle genes&nbsp AT5G02470.3 AAAAGGCCCATTTA core cell cycle genes&nbsp AT5G02530 AT5G02530.1 AAAAGGCCCATTAAG RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae – 2; Bacteria – 1111; Metazoa – 4776; Fungi – 1622; Plants – 1564; Viruses – 50; Other Eukaryotes – 1609 (source: NCBI BLink).&nbsp AT5G02610 AT5G02610.1 ACGGCCCATTAT 60S ribosomal protein L35 (RPL35D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 840 Blast hits to 840 proteins in 308 species: Archae – 109; Bacteria – 145; Metazoa – 237; Fungi – 93; Plants – 90; Viruses – 0; Other Eukaryotes – 166 (source: NCBI BLink).&nbsp AT5G02790 AT5G02790.1 TACGGCCCATTAT In2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae – 2; Bacteria – 698; Metazoa – 592; Fungi – 122; Plants – 984; Viruses – 0; Other Eukaryotes – 413 (source: NCBI BLink).&nbsp AT5G02960 AT5G02960.1 CTTAATGGGCCTAC 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae – 180; Bacteria – 2807; Metazoa – 329; Fungi – 198; Plants – 755; Viruses – 0; Other Eukaryotes – 1855 (source: NCBI BLink).&nbsp AT5G03380 AT5G03380.1 TAAATGGGCCCATTTA heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae – 9; Bacteria – 365; Metazoa – 931; Fungi – 228; Plants – 1424; Viruses – 0; Other Eukaryotes – 488 (source: NCBI BLink).&nbsp AT5G03380.2 TAAATGGGCCCATTTA heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae – 9; Bacteria – 365; Metazoa – 931; Fungi – 228; Plants – 1424; Viruses – 0; Other Eukaryotes – 488 (source: NCBI BLink).&nbsp AT5G03880 AT5G03880.1 TTAAGGCCCAAAAGTAAGGCCCATTAAG electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae – 48; Bacteria – 196; Metazoa – 1; Fungi – 33; Plants – 60; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT5G03880.1 TTAAGGCCCAAAATTAAGGCCCATTAT electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae – 48; Bacteria – 196; Metazoa – 1; Fungi – 33; Plants – 60; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT5G04800 AT5G04800.1 TAGGGCCCATTAA 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae – 117; Bacteria – 0; Metazoa – 270; Fungi – 98; Plants – 83; Viruses – 0; Other Eukaryotes – 159 (source: NCBI BLink).&nbsp AT5G04800.2 TAGGGCCCATTAA 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae – 117; Bacteria – 0; Metazoa – 270; Fungi – 98; Plants – 83; Viruses – 0; Other Eukaryotes – 159 (source: NCBI BLink).&nbsp AT5G04800.3 TAGGGCCCATTAA 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae – 117; Bacteria – 0; Metazoa – 270; Fungi – 98; Plants – 83; Viruses – 0; Other Eukaryotes – 159 (source: NCBI BLink).&nbsp AT5G04800.4 TAGGGCCCATTAA 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae – 117; Bacteria – 0; Metazoa – 270; Fungi – 98; Plants – 83; Viruses – 0; Other Eukaryotes – 159 (source: NCBI BLink).&nbsp AT5G05450 AT5G05450.1 UNEAATGGGCCGAA DEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae – 410; Bacteria – 10515; Metazoa – 4736; Fungi – 3110; Plants – 1301; Viruses – 7; Other Eukaryotes – 5946 (source: NCBI BLink).&nbsp AT5G05470 AT5G05470.1 gAATGGGCCGT protein synthesis initiation factor eIF2 alpha&nbsp AT5G05610 AT5G05610.1 GATGGGCCATGGGCCAGGCCCATTT AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.&nbsp AT5G05610.2 GATGGGCCATGGGCCAGGCCCATTT AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.&nbsp AT5G05670 AT5G05670.1 TTAATGGGCTTTTATTCGGCCCATTAA signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae – 2; Bacteria – 40; Metazoa – 443; Fungi – 156; Plants – 102; Viruses – 0; Other Eukaryotes – 168 (source: NCBI BLink).&nbsp AT5G05670.2 TTAATGGGCTTTTATTCGGCCCATTAA signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae – 2; Bacteria – 40; Metazoa – 443; Fungi – 156; Plants – 102; Viruses – 0; Other Eukaryotes – 168 (source: NCBI BLink).&nbsp AT5G05680 AT5G05680.1 TTAATGGGCCGAATAAAAGCCCATTAA nuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae – 2; Bacteria – 20; Metazoa – 218; Fungi – 31; Plants – 27; Viruses – 0; Other Eukaryotes – 63 (source: NCBI BLink).&nbsp AT5G06310 AT5G06310.1 CGGCCCATTAA Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b.&nbsp AT5G06340 AT5G06340.1 UNEAATGGGCCCAATA ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae – 2; Bacteria – 1483; Metazoa – 9; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 1660 (source: NCBI BLink).&nbsp AT5G06370 AT5G06370.1 AGGGCCCATTT NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT3G02700.1); Has 102 Blast hits to 101 proteins in 29 species: Archae – 0; Bacteria – 28; Metazoa – 4; Fungi – 0; Plants – 67; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT5G07090 AT5G07090.1 UNEAATGGGCCTAT 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae – 166; Bacteria – 0; Metazoa – 329; Fungi – 122; Plants – 101; Viruses – 0; Other Eukaryotes – 224 (source: NCBI BLink).&nbsp AT5G07090.2 UNEAATGGGCCTAT 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae – 166; Bacteria – 0; Metazoa – 329; Fungi – 122; Plants – 101; Viruses – 0; Other Eukaryotes – 224 (source: NCBI BLink).&nbsp AT5G07770 AT5G07770.1 CGGCCCATTGGGCTTC formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: formin homology 2 domain-containing protein / FH2 domain-containing protein (TAIR:AT5G07780.1); Has 30202 Blast hits to 12248 proteins in 656 species: Archae – 50; Bacteria – 2578; Metazoa – 12793; Fungi – 3250; Plants – 6039; Viruses – 1524; Other Eukaryotes – 3968 (source: NCBI BLink).&nbsp AT5G07920 AT5G07920.1 TAATGGGCCTGGGCCCT diacylglycerol kinase&nbsp AT5G08139 AT5G08139.1 TGGCCCATTC zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G60820.1); Has 6373 Blast hits to 6323 proteins in 223 species: Archae – 2; Bacteria – 19; Metazoa – 2188; Fungi – 476; Plants – 2447; Viruses – 45; Other Eukaryotes – 1196 (source: NCBI BLink).&nbsp AT5G08270 AT5G08270.1 CCATTAAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae – 0; Bacteria – 0; Metazoa – 24; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT5G08270.1 TTAAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae – 0; Bacteria – 0; Metazoa – 24; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT5G08540 AT5G08540.1 AAAAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 16; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G08540.1 TAAATGGGCCGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 16; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G09390 AT5G09390.1 TTAAGGCCCATTT CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae – 4; Bacteria – 18; Metazoa – 471; Fungi – 92; Plants – 65; Viruses – 0; Other Eukaryotes – 185 (source: NCBI BLink).&nbsp AT5G09390.2 TTAAGGCCCATTT CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae – 4; Bacteria – 18; Metazoa – 471; Fungi – 92; Plants – 65; Viruses – 0; Other Eukaryotes – 185 (source: NCBI BLink).&nbsp AT5G09450 AT5G09450.1 CATGGGCCCATTAG pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae – 0; Bacteria – 0; Metazoa – 7; Fungi – 6; Plants – 2224; Viruses – 0; Other Eukaryotes – 98 (source: NCBI BLink).&nbsp AT5G09740 AT5G09740.1 CTAATGGGCCTGA Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.&nbsp AT5G09740.2 CTAATGGGCCTGA Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.&nbsp AT5G09880 AT5G09880.1 TAAATGGGCCTTTT RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae – 65; Bacteria – 4369; Metazoa – 40620; Fungi – 8054; Plants – 5837; Viruses – 419; Other Eukaryotes – 15750 (source: NCBI BLink).&nbsp AT5G09900 AT5G09900.1 ATGGCCCATTAG Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.&nbsp AT5G09900.2 ATGGCCCATTAG Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.&nbsp AT5G09900.3 ATGGCCCATTAG Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.&nbsp AT5G10100 AT5G10100.1 GTAGGCCCATTTA trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae – 29; Bacteria – 765; Metazoa – 195; Fungi – 100; Plants – 258; Viruses – 0; Other Eukaryotes – 121 (source: NCBI BLink).&nbsp AT5G10740 AT5G10740.1 AATAGGCCCATTAGCCCAATTG protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae – 9; Bacteria – 1045; Metazoa – 1489; Fungi – 552; Plants – 1360; Viruses – 11; Other Eukaryotes – 1165 (source: NCBI BLink).&nbsp AT5G10745 AT5G10745.1 CAATTGGGCTAATGGGCCTATT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 14; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G10780 AT5G10780.1 TAAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae – 0; Bacteria – 0; Metazoa – 114; Fungi – 83; Plants – 23; Viruses – 0; Other Eukaryotes – 61 (source: NCBI BLink).&nbsp AT5G10780.2 TAAAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae – 0; Bacteria – 0; Metazoa – 114; Fungi – 83; Plants – 23; Viruses – 0; Other Eukaryotes – 61 (source: NCBI BLink).&nbsp AT5G10840 AT5G10840.1 GTTAGGCCCATTg endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae – 0; Bacteria – 38; Metazoa – 446; Fungi – 142; Plants – 235; Viruses – 0; Other Eukaryotes – 196 (source: NCBI BLink).&nbsp AT5G11150 AT5G11150.1 ATAATGGGCCTTG Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.&nbsp AT5G11170 AT5G11170.1 TTTAGGCCCATTAA ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus; EXPRESSED IN: guard cell, root, cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G11200.1); Has 28546 Blast hits to 28139 proteins in 1749 species: Archae – 514; Bacteria – 11832; Metazoa – 5046; Fungi – 3322; Plants – 1384; Viruses – 50; Other Eukaryotes – 6398 (source: NCBI BLink).&nbsp AT5G11200 AT5G11200.1 CTAGGCCCATTAA DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).&nbsp AT5G11200.2 CTAGGCCCATTAA DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).&nbsp AT5G11200.3 CTAGGCCCATTAA DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).&nbsp AT5G11580 AT5G11580.1 TTAATGGGCCTATT UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae – 65; Bacteria – 1617; Metazoa – 6245; Fungi – 716; Plants – 1411; Viruses – 0; Other Eukaryotes – 5600 (source: NCBI BLink).&nbsp AT5G12020 AT5G12020.1 gAATGGGCCTTG 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II); INVOLVED IN: response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 4227 Blast hits to 4227 proteins in 942 species: Archae – 102; Bacteria – 2394; Metazoa – 83; Fungi – 183; Plants – 932; Viruses – 0; Other Eukaryotes – 533 (source: NCBI BLink).&nbsp AT5G12290 AT5G12290.1 TACTGGGCCCATTAAAAGCCCAATAAG Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.&nbsp AT5G12410 AT5G12410.1 CAAGCCCAATAGGCCCATTC THUMP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: THUMP (InterPro:IPR004114); Has 2926 Blast hits to 1988 proteins in 205 species: Archae – 10; Bacteria – 67; Metazoa – 1296; Fungi – 226; Plants – 118; Viruses – 74; Other Eukaryotes – 1135 (source: NCBI BLink).&nbsp AT5G13190 AT5G13190.1 AAAAGGCCCATTAAG INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 2; Fungi – 0; Plants – 19; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G13310 AT5G13310.1 CCATTAAGCCAGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae – 0; Bacteria – 44; Metazoa – 138; Fungi – 38; Plants – 34; Viruses – 0; Other Eukaryotes – 102 (source: NCBI BLink).&nbsp AT5G13970 AT5G13970.1 TGGCCCATTAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae – 2; Bacteria – 47; Metazoa – 119; Fungi – 63; Plants – 38; Viruses – 17; Other Eukaryotes – 322 (source: NCBI BLink).&nbsp AT5G14030 AT5G14030.1 GTAGGCCCATTAT translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 124; Fungi – 0; Plants – 24; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT5G14030.2 GTAGGCCCATTAT translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 124; Fungi – 0; Plants – 24; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT5G14030.3 GTAGGCCCATTAT translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 124; Fungi – 0; Plants – 24; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT5G14030.4 GTAGGCCCATTAT translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae – 0; Bacteria – 0; Metazoa – 124; Fungi – 0; Plants – 24; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT5G14100 AT5G14100.1 AAAAGCCCAATTAAGGCCCATTC member of NAP subfamily&nbsp AT5G14200 AT5G14200.1 UNEAATGGGCCAAT The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids.&nbsp AT5G14200.2 UNEAATGGGCCAAT The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids.&nbsp AT5G14200.3 UNEAATGGGCCAAT The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids.&nbsp AT5G14220 AT5G14220.1 ATAATGGGCCTGA Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.&nbsp AT5G14260 AT5G14260.1 TCAGGCCCATTC SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae – 0; Bacteria – 0; Metazoa – 156; Fungi – 84; Plants – 171; Viruses – 0; Other Eukaryotes – 62 (source: NCBI BLink).&nbsp AT5G14260.2 TCAGGCCCATTC SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae – 0; Bacteria – 0; Metazoa – 156; Fungi – 84; Plants – 171; Viruses – 0; Other Eukaryotes – 62 (source: NCBI BLink).&nbsp AT5G14260.3 TCAGGCCCATTC SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae – 0; Bacteria – 0; Metazoa – 156; Fungi – 84; Plants – 171; Viruses – 0; Other Eukaryotes – 62 (source: NCBI BLink).&nbsp AT5G14430 AT5G14430.1 ACAGGCCCATTTA dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae – 0; Bacteria – 103; Metazoa – 0; Fungi – 0; Plants – 469; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT5G14430.2 ACAGGCCCATTTA dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae – 0; Bacteria – 103; Metazoa – 0; Fungi – 0; Plants – 469; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT5G14680 AT5G14680.1 CAATGGGCCCGTT universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G01520.1); Has 1288 Blast hits to 1284 proteins in 330 species: Archae – 88; Bacteria – 759; Metazoa – 35; Fungi – 21; Plants – 361; Viruses – 0; Other Eukaryotes – 24 (source: NCBI BLink).&nbsp AT5G15020 AT5G15020.1 TTAATGGGCCTAAT Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).&nbsp AT5G15320 AT5G15320.1 AGAGGCCCATTTAAAGCCCAATAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G15320.2 AGAGGCCCATTTAAAGCCCAATAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G16250 AT5G16250.1 ACGGCCCATTAGGCCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 56; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G16260 AT5G16260.1 GGGCCTAATGGGCCg RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae – 0; Bacteria – 82; Metazoa – 1049; Fungi – 296; Plants – 184; Viruses – 0; Other Eukaryotes – 156 (source: NCBI BLink).&nbsp AT5G16380 AT5G16380.1 ATATGGGCTGAATAAGGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 277 Blast hits to 277 proteins in 13 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 276; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT5G16610 AT5G16610.1 ATTGGCCCATTAGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae – 0; Bacteria – 6; Metazoa – 0; Fungi – 0; Plants – 18; Viruses – 0; Other Eukaryotes – 7 (source: NCBI BLink).&nbsp AT5G16610.2 ATTGGCCCATTAGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae – 0; Bacteria – 6; Metazoa – 0; Fungi – 0; Plants – 18; Viruses – 0; Other Eukaryotes – 7 (source: NCBI BLink).&nbsp AT5G17190 AT5G17190.1 AATAGGCCCATTAAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 58; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G17620 AT5G17620.1 UNEAATGGGCCAAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant nuclear matrix 1 (InterPro:IPR010604); Has 62 Blast hits to 62 proteins in 32 species: Archae – 0; Bacteria – 19; Metazoa – 8; Fungi – 0; Plants – 31; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT5G18110 AT5G18110.1 CTAAGGCCCATTTA NOVEL CAP-BINDING PROTEIN (NCBP); FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 4E (eIF-4E) (InterPro:IPR001040); BEST Arabidopsis thaliana protein match is: EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap binding / protein binding / translation initiation factor (TAIR:AT4G18040.1); Has 1298 Blast hits to 1298 proteins in 204 species: Archae – 0; Bacteria – 0; Metazoa – 608; Fungi – 226; Plants – 212; Viruses – 0; Other Eukaryotes – 252 (source: NCBI BLink).&nbsp AT5G18120 AT5G18120.1 TAAATGGGCCTTAG Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group.&nbsp AT5G18400 AT5G18400.1 TAAATGGGCCGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae – 0; Bacteria – 0; Metazoa – 121; Fungi – 101; Plants – 35; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT5G18400.2 TAAATGGGCCGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae – 0; Bacteria – 0; Metazoa – 121; Fungi – 101; Plants – 35; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT5G18400.3 TAAATGGGCCGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae – 0; Bacteria – 0; Metazoa – 121; Fungi – 101; Plants – 35; Viruses – 0; Other Eukaryotes – 53 (source: NCBI BLink).&nbsp AT5G18440 AT5G18440.1 TGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae – 0; Bacteria – 93; Metazoa – 319; Fungi – 137; Plants – 52; Viruses – 6; Other Eukaryotes – 626 (source: NCBI BLink).&nbsp AT5G18440.2 TGGCCCATTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae – 0; Bacteria – 93; Metazoa – 319; Fungi – 137; Plants – 52; Viruses – 6; Other Eukaryotes – 626 (source: NCBI BLink).&nbsp AT5G18790 AT5G18790.1 TTAATGGGCCGAA ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT3G06320.1); Has 1786 Blast hits to 1786 proteins in 750 species: Archae – 0; Bacteria – 1570; Metazoa – 22; Fungi – 13; Plants – 30; Viruses – 0; Other Eukaryotes – 151 (source: NCBI BLink).&nbsp AT5G18800 AT5G18800.1 TTCGGCCCATTAA NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae – 0; Bacteria – 0; Metazoa – 125; Fungi – 73; Plants – 35; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G18800.2 TTCGGCCCATTAA NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae – 0; Bacteria – 0; Metazoa – 125; Fungi – 73; Plants – 35; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G19300 AT5G19300.1 TGAGGCCCATTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein of unknown function DUF171 (InterPro:IPR003750); Has 4766 Blast hits to 2044 proteins in 217 species: Archae – 72; Bacteria – 102; Metazoa – 2264; Fungi – 372; Plants – 195; Viruses – 4; Other Eukaryotes – 1757 (source: NCBI BLink).&nbsp AT5G20140 AT5G20140.1 gAATGGGCCTC SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae – 10; Bacteria – 204; Metazoa – 88; Fungi – 0; Plants – 111; Viruses – 0; Other Eukaryotes – 935 (source: NCBI BLink).&nbsp AT5G20160 AT5G20160.1 CCAGGCCCATTAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae – 226; Bacteria – 0; Metazoa – 321; Fungi – 181; Plants – 101; Viruses – 0; Other Eukaryotes – 247 (source: NCBI BLink).&nbsp AT5G20160.2 CCAGGCCCATTAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae – 226; Bacteria – 0; Metazoa – 321; Fungi – 181; Plants – 101; Viruses – 0; Other Eukaryotes – 247 (source: NCBI BLink).&nbsp AT5G20160.3 CCAGGCCCATTAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae – 226; Bacteria – 0; Metazoa – 321; Fungi – 181; Plants – 101; Viruses – 0; Other Eukaryotes – 247 (source: NCBI BLink).&nbsp AT5G22330 AT5G22330.1 TAAAGGCCCATTg RESISTANCE TO PSEUDOMONAS SYRINGAE PV MACULICOLA INTERACTOR 1 (RIN1); FUNCTIONS IN: protein binding; INVOLVED IN: defense response to fungus, incompatible interaction, meristem development; LOCATED IN: nucleolus, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TIP49, C-terminal (InterPro:IPR010339), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: DNA helicase, putative (TAIR:AT5G67630.1); Has 2675 Blast hits to 2634 proteins in 789 species: Archae – 254; Bacteria – 1222; Metazoa – 326; Fungi – 290; Plants – 78; Viruses – 0; Other Eukaryotes – 505 (source: NCBI BLink).&nbsp AT5G22340 AT5G22340.1 CAATGGGCCTTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT5G22340.2 CAATGGGCCTTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 1 (source: NCBI BLink).&nbsp AT5G22875 AT5G22875.1 TACGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 19; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G22875.2 TACGGCCCATTTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 19; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G23080 AT5G23080.1 CTAATGGGCCGAA Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.&nbsp AT5G23080.2 CTAATGGGCCGAA Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.&nbsp AT5G23090 AT5G23090.1 TTCGGCCCATTAG NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 235; Plants – 292; Viruses – 0; Other Eukaryotes – 76 (source: NCBI BLink).&nbsp AT5G23090.2 TTCGGCCCATTAG NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 235; Plants – 292; Viruses – 0; Other Eukaryotes – 76 (source: NCBI BLink).&nbsp AT5G23090.3 TTCGGCCCATTAG NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 235; Plants – 292; Viruses – 0; Other Eukaryotes – 76 (source: NCBI BLink).&nbsp AT5G23090.4 TTCGGCCCATTAG NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae – 0; Bacteria – 0; Metazoa – 384; Fungi – 235; Plants – 292; Viruses – 0; Other Eukaryotes – 76 (source: NCBI BLink).&nbsp AT5G23200 AT5G23200.1 UNEAATGGGCCCAAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae – 0; Bacteria – 0; Metazoa – 25; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT5G23200.1 TTTAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae – 0; Bacteria – 0; Metazoa – 25; Fungi – 0; Plants – 22; Viruses – 0; Other Eukaryotes – 5 (source: NCBI BLink).&nbsp AT5G23230 AT5G23230.1 CTAGGCCCATTT NICOTINAMIDASE 2 (NIC2); FUNCTIONS IN: nicotinamidase activity, catalytic activity; INVOLVED IN: NAD metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); BEST Arabidopsis thaliana protein match is: NIC3 (NICOTINAMIDASE 3); catalytic/ nicotinamidase (TAIR:AT5G23220.1); Has 4281 Blast hits to 4279 proteins in 809 species: Archae – 137; Bacteria – 3598; Metazoa – 0; Fungi – 94; Plants – 51; Viruses – 0; Other Eukaryotes – 401 (source: NCBI BLink).&nbsp AT5G23250 AT5G23250.1 CAATGGGCCTTAA succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae – 196; Bacteria – 2692; Metazoa – 350; Fungi – 188; Plants – 87; Viruses – 0; Other Eukaryotes – 3601 (source: NCBI BLink).&nbsp AT5G23250.2 CAATGGGCCTTAA succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae – 196; Bacteria – 2692; Metazoa – 350; Fungi – 188; Plants – 87; Viruses – 0; Other Eukaryotes – 3601 (source: NCBI BLink).&nbsp AT5G23290 AT5G23290.1 TAAATGGGCCAATATGGGCCTTAT PREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae – 46; Bacteria – 3; Metazoa – 137; Fungi – 83; Plants – 26; Viruses – 0; Other Eukaryotes – 70 (source: NCBI BLink).&nbsp AT5G23420 AT5G23420.1 ATAATGGGCCTCA Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain.&nbsp AT5G23900 AT5G23900.1 CCAGGCCCATTTA 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae – 0; Bacteria – 0; Metazoa – 227; Fungi – 113; Plants – 98; Viruses – 0; Other Eukaryotes – 108 (source: NCBI BLink).&nbsp AT5G24520 AT5G24520.1 AAAAGGCCCATTAT Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.&nbsp AT5G24520.2 AAAAGGCCCATTAT Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.&nbsp AT5G24520.3 AAAAGGCCCATTAT Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.&nbsp AT5G24810 AT5G24810.1 GATGACGTGGCCCATTg ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae – 93; Bacteria – 6015; Metazoa – 395; Fungi – 388; Plants – 356; Viruses – 16; Other Eukaryotes – 4320 (source: NCBI BLink).&nbsp AT5G24830 AT5G24830.1 TTAATGGGCCATAGCCCAAAA pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae – 6; Bacteria – 14; Metazoa – 418; Fungi – 405; Plants – 20611; Viruses – 0; Other Eukaryotes – 881 (source: NCBI BLink).&nbsp AT5G24970 AT5G24970.1 TTAATGGGCCTGA ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae – 69; Bacteria – 2644; Metazoa – 345; Fungi – 303; Plants – 352; Viruses – 14; Other Eukaryotes – 3721 (source: NCBI BLink).&nbsp AT5G24980 AT5G24980.1 TCAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G25070 AT5G25070.1 TTAAGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae – 1252; Bacteria – 11295; Metazoa – 39436; Fungi – 6166; Plants – 3117; Viruses – 367; Other Eukaryotes – 20051 (source: NCBI BLink).&nbsp AT5G25080 AT5G25080.1 TTAATGGGCCTTAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146), Exosome-associated factor Rrp47/DNA strand repair C1D (InterPro:IPR011082); Has 137 Blast hits to 137 proteins in 56 species: Archae – 0; Bacteria – 0; Metazoa – 76; Fungi – 42; Plants – 16; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT5G25100 AT5G25100.1 ATTAGGCCCATTTA endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1029 Blast hits to 1012 proteins in 169 species: Archae – 0; Bacteria – 14; Metazoa – 445; Fungi – 142; Plants – 236; Viruses – 0; Other Eukaryotes – 192 (source: NCBI BLink).&nbsp AT5G25475 AT5G25475.1 TAAATGGGCCTTATTCGGCCCGTTA DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 59; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G25475.2 TAAATGGGCCTTATTCGGCCCGTTA DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 59; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G25475.3 TAAATGGGCCTTATTCGGCCCGTTA DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 59; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G25510 AT5G25510.1 TAAATGGGCCTTAG serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae – 0; Bacteria – 0; Metazoa – 492; Fungi – 97; Plants – 156; Viruses – 0; Other Eukaryotes – 110 (source: NCBI BLink).&nbsp AT5G25520 AT5G25520.1 CTAAGGCCCATTTA transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae – 0; Bacteria – 102; Metazoa – 757; Fungi – 263; Plants – 95; Viruses – 7; Other Eukaryotes – 484 (source: NCBI BLink).&nbsp AT5G25520.2 CTAAGGCCCATTTA transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae – 0; Bacteria – 102; Metazoa – 757; Fungi – 263; Plants – 95; Viruses – 7; Other Eukaryotes – 484 (source: NCBI BLink).&nbsp AT5G25930 AT5G25930.1 ATGGCCCATTT leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: AtRLP52 (Receptor Like Protein 52); kinase/ protein binding (TAIR:AT5G25910.1); Has 141916 Blast hits to 99081 proteins in 3479 species: Archae – 73; Bacteria – 11637; Metazoa – 53989; Fungi – 7333; Plants – 48905; Viruses – 349; Other Eukaryotes – 19630 (source: NCBI BLink).&nbsp AT5G26360 AT5G26360.1 TTAATGGGCCTTAG chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, gamma subunit (InterPro:IPR012719), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G11830.1); Has 12411 Blast hits to 12269 proteins in 2241 species: Archae – 394; Bacteria – 5329; Metazoa – 1841; Fungi – 951; Plants – 480; Viruses – 2; Other Eukaryotes – 3414 (source: NCBI BLink).&nbsp AT5G26880 AT5G26880.1 gAATGGGCCTAAA tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 3878 Blast hits to 3878 proteins in 1119 species: Archae – 0; Bacteria – 2309; Metazoa – 3; Fungi – 0; Plants – 20; Viruses – 0; Other Eukaryotes – 1546 (source: NCBI BLink).&nbsp AT5G27120 AT5G27120.1 CTAATGGGCCAA SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein&nbsp AT5G27400 AT5G27400.1 TATAGGCCCATTAGGCCCAAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae – 0; Bacteria – 62; Metazoa – 389; Fungi – 161; Plants – 105; Viruses – 0; Other Eukaryotes – 89 (source: NCBI BLink).&nbsp AT5G27770 AT5G27770.1 TCGGCCCATTAG 60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae – 0; Bacteria – 0; Metazoa – 251; Fungi – 89; Plants – 73; Viruses – 0; Other Eukaryotes – 79 (source: NCBI BLink).&nbsp AT5G28370 AT5G28370.1 UNEAATGGGCCCAACT pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae – 7; Bacteria – 27; Metazoa – 841; Fungi – 534; Plants – 20012; Viruses – 0; Other Eukaryotes – 1085 (source: NCBI BLink).&nbsp AT5G35530 AT5G35530.1 UNEAATGGGCCTTAAAAGGCCGGGCCTTG 40S ribosomal protein S3 (RPS3C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3A) (TAIR:AT2G31610.1); Has 3856 Blast hits to 3855 proteins in 1171 species: Archae – 174; Bacteria – 1930; Metazoa – 296; Fungi – 95; Plants – 109; Viruses – 0; Other Eukaryotes – 1252 (source: NCBI BLink).&nbsp AT5G37050 AT5G37050.1 TTAAAGGCCCAATGGGCCGAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 23 Blast hits to 19 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 23; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G38040 AT5G38040.1 CTAATGGGCCAAT UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G38010.1); Has 4566 Blast hits to 4539 proteins in 305 species: Archae – 0; Bacteria – 130; Metazoa – 1639; Fungi – 14; Plants – 2694; Viruses – 70; Other Eukaryotes – 19 (source: NCBI BLink).&nbsp AT5G38480 AT5G38480.1 GTTGGGCCCAGTGGCCCATTTA general regulatory factor, a 14-3-3 gene&nbsp AT5G38480.2 GTTGGGCCCAGTGGCCCATTTA general regulatory factor, a 14-3-3 gene&nbsp AT5G38650 AT5G38650.1 AAAAGCCCAAATGGGCCTTG proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT1G67250.1); Has 161 Blast hits to 161 proteins in 51 species: Archae – 0; Bacteria – 0; Metazoa – 87; Fungi – 0; Plants – 61; Viruses – 0; Other Eukaryotes – 13 (source: NCBI BLink).&nbsp AT5G39210 AT5G39210.1 GTGGCCCATTAA Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex.&nbsp AT5G39850 AT5G39850.1 AAAAAGCCCAATGGGCCAA 40S ribosomal protein S9 (RPS9C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9B) (TAIR:AT5G15200.1); Has 5400 Blast hits to 5397 proteins in 2680 species: Archae – 171; Bacteria – 348; Metazoa – 335; Fungi – 191; Plants – 3457; Viruses – 0; Other Eukaryotes – 898 (source: NCBI BLink).&nbsp AT5G40200 AT5G40200.1 TCAGGCCCATTT Encodes a putative DegP protease.&nbsp AT5G40770 AT5G40770.1 TTGGCCCATTAA prohibitin 3&nbsp AT5G41190 AT5G41190.1 ATTTGGGCCTTGTGAGGCCCATTTA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881), D-site 20S pre-rRNA nuclease (InterPro:IPR017117); Has 855 Blast hits to 653 proteins in 196 species: Archae – 53; Bacteria – 16; Metazoa – 335; Fungi – 168; Plants – 29; Viruses – 10; Other Eukaryotes – 244 (source: NCBI BLink).&nbsp AT5G41560 AT5G41560.1 GTAGGCCCAATGGGCCCATAA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 59 Blast hits to 59 proteins in 19 species: Archae – 0; Bacteria – 0; Metazoa – 46; Fungi – 0; Plants – 13; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G41600 AT5G41600.1 TAAATGGGCCCAATG VIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae – 0; Bacteria – 0; Metazoa – 648; Fungi – 2; Plants – 271; Viruses – 0; Other Eukaryotes – 18 (source: NCBI BLink).&nbsp AT5G41600.1 TAAATGGGCCTTAA VIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae – 0; Bacteria – 0; Metazoa – 648; Fungi – 2; Plants – 271; Viruses – 0; Other Eukaryotes – 18 (source: NCBI BLink).&nbsp AT5G41940 AT5G41940.1 AAGGCCCATTAA RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae – 2; Bacteria – 83; Metazoa – 1894; Fungi – 490; Plants – 337; Viruses – 5; Other Eukaryotes – 672 (source: NCBI BLink).&nbsp AT5G41960 AT5G41960.1 GGCTTTAACGGCCCATTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 14; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G42000 AT5G42000.1 TAATGGGCCTCT ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae – 0; Bacteria – 0; Metazoa – 233; Fungi – 101; Plants – 52; Viruses – 0; Other Eukaryotes – 12 (source: NCBI BLink).&nbsp AT5G42000.2 TAATGGGCCTCT ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae – 0; Bacteria – 0; Metazoa – 233; Fungi – 101; Plants – 52; Viruses – 0; Other Eukaryotes – 12 (source: NCBI BLink).&nbsp AT5G42060 AT5G42060.1 ATCGGCCCATTTA unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64490.1); Has 37 Blast hits to 36 proteins in 5 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 37; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G43330 AT5G43330.1 ATTGGCCCATTAT malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae – 116; Bacteria – 4254; Metazoa – 1034; Fungi – 184; Plants – 466; Viruses – 0; Other Eukaryotes – 2201 (source: NCBI BLink).&nbsp AT5G44040 AT5G44040.1 AAAACGGCCCATTAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G04030.1); Has 753 Blast hits to 701 proteins in 137 species: Archae – 2; Bacteria – 60; Metazoa – 161; Fungi – 91; Plants – 57; Viruses – 6; Other Eukaryotes – 376 (source: NCBI BLink).&nbsp AT5G44320 AT5G44320.1 AAAAGCCCATTGAGGCCCATTAAG eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae – 0; Bacteria – 0; Metazoa – 173; Fungi – 61; Plants – 40; Viruses – 0; Other Eukaryotes – 67 (source: NCBI BLink).&nbsp AT5G45360 AT5G45360.1 TATGGCCCATTTA F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 132 Blast hits to 132 proteins in 38 species: Archae – 0; Bacteria – 2; Metazoa – 76; Fungi – 0; Plants – 44; Viruses – 0; Other Eukaryotes – 10 (source: NCBI BLink).&nbsp AT5G45775 AT5G45775.1 ATTGGCCCATTAA 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae – 218; Bacteria – 2825; Metazoa – 209; Fungi – 107; Plants – 188; Viruses – 0; Other Eukaryotes – 1716 (source: NCBI BLink).&nbsp AT5G45775.2 ATTGGCCCATTAA 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae – 218; Bacteria – 2825; Metazoa – 209; Fungi – 107; Plants – 188; Viruses – 0; Other Eukaryotes – 1716 (source: NCBI BLink).&nbsp AT5G45990 AT5G45990.1 TAAATGGGCCAT crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae – 15; Bacteria – 34; Metazoa – 1807; Fungi – 1089; Plants – 496; Viruses – 0; Other Eukaryotes – 502 (source: NCBI BLink).&nbsp AT5G45990.1 TTTAGGCCCATTAAG crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae – 15; Bacteria – 34; Metazoa – 1807; Fungi – 1089; Plants – 496; Viruses – 0; Other Eukaryotes – 502 (source: NCBI BLink).&nbsp AT5G46030 AT5G46030.1 TAAATGGGCCTTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae – 2; Bacteria – 26; Metazoa – 1582; Fungi – 186; Plants – 111; Viruses – 40; Other Eukaryotes – 509 (source: NCBI BLink).&nbsp AT5G46630 AT5G46630.1 DCGGCCCATTC clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes&nbsp AT5G46630.2 DCGGCCCATTC clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes&nbsp AT5G47320 AT5G47320.1 CATTGGGCCCATTAT Nuclear encoded mitochondrial ribosome subunit.&nbsp AT5G47435 AT5G47435.1 CTTATTGGGCCCATTT encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.&nbsp AT5G47435.2 CTTATTGGGCCCATTT encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.&nbsp AT5G47690 AT5G47690.1 CTAATGGGCCTGG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae – 10; Bacteria – 207; Metazoa – 2980; Fungi – 748; Plants – 470; Viruses – 130; Other Eukaryotes – 2220 (source: NCBI BLink).&nbsp AT5G47690.2 CTAATGGGCCTGG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae – 10; Bacteria – 207; Metazoa – 2980; Fungi – 748; Plants – 470; Viruses – 130; Other Eukaryotes – 2220 (source: NCBI BLink).&nbsp AT5G47690.3 CTAATGGGCCTGG binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae – 10; Bacteria – 207; Metazoa – 2980; Fungi – 748; Plants – 470; Viruses – 130; Other Eukaryotes – 2220 (source: NCBI BLink).&nbsp AT5G47700 AT5G47700.1 TAAATGGGCCTAAT 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae – 49; Bacteria – 5; Metazoa – 682; Fungi – 360; Plants – 319; Viruses – 0; Other Eukaryotes – 268 (source: NCBI BLink).&nbsp AT5G47700.2 TAAATGGGCCTAAT 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae – 49; Bacteria – 5; Metazoa – 682; Fungi – 360; Plants – 319; Viruses – 0; Other Eukaryotes – 268 (source: NCBI BLink).&nbsp AT5G47860 AT5G47860.1 GTGGCCCATTAAG unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae – 0; Bacteria – 111; Metazoa – 0; Fungi – 0; Plants – 41; Viruses – 0; Other Eukaryotes – 137 (source: NCBI BLink).&nbsp AT5G47880 AT5G47880.1 TACTGGGCTTAGGCCCATTAA Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.&nbsp AT5G47880.1 TTCGGCCCATTAAG Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.&nbsp AT5G47880.2 TACTGGGCTTAGGCCCATTAA Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.&nbsp AT5G47880.2 TTCGGCCCATTAAG Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.&nbsp AT5G49000 AT5G49000.1 ATAAGGCCCATTAAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae – 10; Bacteria – 167; Metazoa – 4114; Fungi – 13; Plants – 659; Viruses – 110; Other Eukaryotes – 162 (source: NCBI BLink).&nbsp AT5G49000.2 ATAAGGCCCATTAAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae – 10; Bacteria – 167; Metazoa – 4114; Fungi – 13; Plants – 659; Viruses – 110; Other Eukaryotes – 162 (source: NCBI BLink).&nbsp AT5G49510 AT5G49510.1 TAATGGGCCTG PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae – 0; Bacteria – 0; Metazoa – 138; Fungi – 87; Plants – 23; Viruses – 0; Other Eukaryotes – 62 (source: NCBI BLink).&nbsp AT5G49510.2 TAATGGGCCTG PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae – 0; Bacteria – 0; Metazoa – 138; Fungi – 87; Plants – 23; Viruses – 0; Other Eukaryotes – 62 (source: NCBI BLink).&nbsp AT5G49610 AT5G49610.1 ATAATGGGCCTTGGGCCTAG F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G33530.1); Has 993 Blast hits to 986 proteins in 45 species: Archae – 0; Bacteria – 0; Metazoa – 9; Fungi – 0; Plants – 981; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT5G49610.1 ATTGGCCCATTC F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G33530.1); Has 993 Blast hits to 986 proteins in 45 species: Archae – 0; Bacteria – 0; Metazoa – 9; Fungi – 0; Plants – 981; Viruses – 0; Other Eukaryotes – 3 (source: NCBI BLink).&nbsp AT5G50870 AT5G50870.1 ATAATGGGCCTAG ubiquitin-conjugating enzyme 27 (UBC27); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: UBC8 (UBIQUITIN CONJUGATING ENZYME 8); protein binding / ubiquitin-protein ligase (TAIR:AT5G41700.4); Has 7501 Blast hits to 7499 proteins in 306 species: Archae – 0; Bacteria – 0; Metazoa – 3692; Fungi – 1438; Plants – 1085; Viruses – 19; Other Eukaryotes – 1267 (source: NCBI BLink).&nbsp AT5G51300 AT5G51300.1 ATTTGGGCTTATAATGGGCCAA splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae – 38; Bacteria – 5736; Metazoa – 34755; Fungi – 10953; Plants – 9084; Viruses – 1148; Other Eukaryotes – 7507 (source: NCBI BLink).&nbsp AT5G51300.2 ATTTGGGCTTATAATGGGCCAA splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae – 38; Bacteria – 5736; Metazoa – 34755; Fungi – 10953; Plants – 9084; Viruses – 1148; Other Eukaryotes – 7507 (source: NCBI BLink).&nbsp AT5G51300.3 ATTTGGGCTTATAATGGGCCAA splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae – 38; Bacteria – 5736; Metazoa – 34755; Fungi – 10953; Plants – 9084; Viruses – 1148; Other Eukaryotes – 7507 (source: NCBI BLink).&nbsp AT5G51340 AT5G51340.1 AACGGGCCTAAATGGGCCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae – 0; Bacteria – 2; Metazoa – 115; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 4 (source: NCBI BLink).&nbsp AT5G51620 AT5G51620.1 UNEAATGGGCCCAGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G51620.2 UNEAATGGGCCCAGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G51620.3 UNEAATGGGCCCAGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G51910 AT5G51910.1 CAAGGCCCATTAG TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 547; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G51910.2 CAAGGCCCATTAG TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 547; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G52380 AT5G52380.1 AATAGGCCCATTTA zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G43590.1); Has 2838 Blast hits to 1585 proteins in 218 species: Archae – 0; Bacteria – 0; Metazoa – 882; Fungi – 700; Plants – 374; Viruses – 490; Other Eukaryotes – 392 (source: NCBI BLink).&nbsp AT5G52470 AT5G52470.1 ATCGGCCCATTAT encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.&nbsp AT5G52470.2 ATCGGCCCATTAT encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.&nbsp AT5G52820 AT5G52820.1 TTCGGCCCATTAATTAAAGGC WD-40 repeat family protein / notchless protein, putative; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), G-protein, beta subunit (InterPro:IPR001632); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 92804 Blast hits to 28593 proteins in 717 species: Archae – 60; Bacteria – 7422; Metazoa – 44321; Fungi – 18160; Plants – 9806; Viruses – 6; Other Eukaryotes – 13029 (source: NCBI BLink).&nbsp AT5G52840 AT5G52840.1 ATAAGGCCCATTAT NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae – 0; Bacteria – 0; Metazoa – 153; Fungi – 69; Plants – 31; Viruses – 0; Other Eukaryotes – 19 (source: NCBI BLink).&nbsp AT5G52840.1 ATTAGGCCCATTAA NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae – 0; Bacteria – 0; Metazoa – 153; Fungi – 69; Plants – 31; Viruses – 0; Other Eukaryotes – 19 (source: NCBI BLink).&nbsp AT5G53940 AT5G53940.1 UNEAATGGGCCCAGTTAAGGCCCAACA yippee family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 696 Blast hits to 696 proteins in 148 species: Archae – 0; Bacteria – 0; Metazoa – 401; Fungi – 132; Plants – 111; Viruses – 0; Other Eukaryotes – 52 (source: NCBI BLink).&nbsp AT5G54940 AT5G54940.1 CTTAATGGGCCTAC eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae – 21; Bacteria – 4; Metazoa – 295; Fungi – 105; Plants – 120; Viruses – 3; Other Eukaryotes – 90 (source: NCBI BLink).&nbsp AT5G54940.2 CTTAATGGGCCTAC eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae – 21; Bacteria – 4; Metazoa – 295; Fungi – 105; Plants – 120; Viruses – 3; Other Eukaryotes – 90 (source: NCBI BLink).&nbsp AT5G55310 AT5G55310.1 UNEAATGGGCCTT Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.&nbsp AT5G55610 AT5G55610.1 TTAATGGGCCTTAA unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G55610.2 TTAATGGGCCTTAA unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 28; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G56120 AT5G56120.1 TTCGGCCCATTAAAGGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12870.1); Has 51 Blast hits to 51 proteins in 6 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 0; Plants – 51; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G56360 AT5G56360.1 CTAATGGGCCTATT calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae – 253; Bacteria – 7152; Metazoa – 21077; Fungi – 6018; Plants – 1646; Viruses – 404; Other Eukaryotes – 15942 (source: NCBI BLink).&nbsp AT5G56360.1 TATAGGCCCATTAG calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae – 253; Bacteria – 7152; Metazoa – 21077; Fungi – 6018; Plants – 1646; Viruses – 404; Other Eukaryotes – 15942 (source: NCBI BLink).&nbsp AT5G56710 AT5G56710.1 AATAGGCCCATTAAAGCCCAAT 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae – 102; Bacteria – 2; Metazoa – 389; Fungi – 88; Plants – 124; Viruses – 0; Other Eukaryotes – 152 (source: NCBI BLink).&nbsp AT5G56710.2 AATAGGCCCATTAAAGCCCAAT 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae – 102; Bacteria – 2; Metazoa – 389; Fungi – 88; Plants – 124; Viruses – 0; Other Eukaryotes – 152 (source: NCBI BLink).&nbsp AT5G57300 AT5G57300.1 ATAATGGGCCTTTT UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae – 70; Bacteria – 2991; Metazoa – 110; Fungi – 84; Plants – 108; Viruses – 0; Other Eukaryotes – 2777 (source: NCBI BLink).&nbsp AT5G57300.2 ATAATGGGCCTTTT UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae – 70; Bacteria – 2991; Metazoa – 110; Fungi – 84; Plants – 108; Viruses – 0; Other Eukaryotes – 2777 (source: NCBI BLink).&nbsp AT5G57440 AT5G57440.1 TGAACCGGCCCATTTA a member of haloacid dehalogenase-like hydrolase family&nbsp AT5G57490 AT5G57490.1 gAATGGGCCTCA Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.&nbsp AT5G57590 AT5G57590.1 CCAGGCCCATTAG Mutant complemented by E coli Bio A gene encoding 7,8-diaminopelargonic acid aminotransferase.&nbsp AT5G57815 AT5G57815.1 TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae – 0; Bacteria – 0; Metazoa – 243; Fungi – 77; Plants – 83; Viruses – 0; Other Eukaryotes – 23 (source: NCBI BLink).&nbsp AT5G57930 AT5G57930.1 GCCCATTAAAGGCCCATTAT ACCUMULATION OF PHOTOSYSTEM ONE 2&nbsp AT5G57930.2 GCCCATTAAAGGCCCATTAT ACCUMULATION OF PHOTOSYSTEM ONE 2&nbsp AT5G58005 AT5G58005.1 TTTTGGGCCGGGCCTAAATGGGCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae – 0; Bacteria – 0; Metazoa – 33; Fungi – 28; Plants – 24; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G58005.2 TTTTGGGCCGGGCCTAAATGGGCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae – 0; Bacteria – 0; Metazoa – 33; Fungi – 28; Plants – 24; Viruses – 0; Other Eukaryotes – 2 (source: NCBI BLink).&nbsp AT5G58070 AT5G58070.1 TATGGCCCATTg Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane.&nbsp AT5G58130 AT5G58130.1 CTAATGGGCCTTA RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae – 145; Bacteria – 5890; Metazoa – 2525; Fungi – 1196; Plants – 360; Viruses – 129; Other Eukaryotes – 2969 (source: NCBI BLink).&nbsp AT5G58140 AT5G58140.1 ATAAGGCCCATTAG Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.&nbsp AT5G58140.2 ATAAGGCCCATTAG Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.&nbsp AT5G58140.3 ATAAGGCCCATTAG Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.&nbsp AT5G58140.4 ATAAGGCCCATTAG Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.&nbsp AT5G58210 AT5G58210.1 CAATGGGCCAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae – 22; Bacteria – 448; Metazoa – 785; Fungi – 532; Plants – 137; Viruses – 42; Other Eukaryotes – 1573 (source: NCBI BLink).&nbsp AT5G58210.2 CAATGGGCCAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae – 22; Bacteria – 448; Metazoa – 785; Fungi – 532; Plants – 137; Viruses – 42; Other Eukaryotes – 1573 (source: NCBI BLink).&nbsp AT5G58210.3 CAATGGGCCAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae – 22; Bacteria – 448; Metazoa – 785; Fungi – 532; Plants – 137; Viruses – 42; Other Eukaryotes – 1573 (source: NCBI BLink).&nbsp AT5G58210.4 CAATGGGCCAA hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae – 22; Bacteria – 448; Metazoa – 785; Fungi – 532; Plants – 137; Viruses – 42; Other Eukaryotes – 1573 (source: NCBI BLink).&nbsp AT5G58220 AT5G58220.1 AAAAGGCCCATTT Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae – 2; Bacteria – 1026; Metazoa – 464; Fungi – 57; Plants – 26; Viruses – 0; Other Eukaryotes – 619 (source: NCBI BLink).&nbsp AT5G58220.2 AAAAGGCCCATTT Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae – 2; Bacteria – 1026; Metazoa – 464; Fungi – 57; Plants – 26; Viruses – 0; Other Eukaryotes – 619 (source: NCBI BLink).&nbsp AT5G58220.3 AAAAGGCCCATTT Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae – 2; Bacteria – 1026; Metazoa – 464; Fungi – 57; Plants – 26; Viruses – 0; Other Eukaryotes – 619 (source: NCBI BLink).&nbsp AT5G58230 AT5G58230.1 UNEAATGGGCCTTTT Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1.&nbsp AT5G58290 AT5G58290.1 AAAAGGCCCATTTA 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA,&nbsp AT5G58410 AT5G58410.1 ATGGCCCATTAT binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Armadillo-type fold (InterPro:IPR016024); Has 531 Blast hits to 394 proteins in 135 species: Archae – 0; Bacteria – 2; Metazoa – 226; Fungi – 140; Plants – 48; Viruses – 0; Other Eukaryotes – 115 (source: NCBI BLink).&nbsp AT5G58420 AT5G58420.1 TAAATGGGCCTCT 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae – 166; Bacteria – 0; Metazoa – 329; Fungi – 122; Plants – 101; Viruses – 0; Other Eukaryotes – 223 (source: NCBI BLink).&nbsp AT5G58440 AT5G58440.1 CTAATGGGCCTAAACAAGCCCAT SORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae – 7; Bacteria – 6; Metazoa – 1144; Fungi – 391; Plants – 81; Viruses – 0; Other Eukaryotes – 146 (source: NCBI BLink).&nbsp AT5G58510 AT5G58510.1 ATAATGGGCCAATATTAGGCCTATT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae – 0; Bacteria – 2; Metazoa – 119; Fungi – 0; Plants – 43; Viruses – 0; Other Eukaryotes – 23 (source: NCBI BLink).&nbsp AT5G58950 AT5G58950.1 TTAATGGGCCGAA protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae – 57; Bacteria – 8154; Metazoa – 43395; Fungi – 8207; Plants – 19435; Viruses – 506; Other Eukaryotes – 17533 (source: NCBI BLink).&nbsp AT5G59140 AT5G59140.1 ATAATGGGCCTC SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae – 0; Bacteria – 0; Metazoa – 188; Fungi – 77; Plants – 28; Viruses – 0; Other Eukaryotes – 20 (source: NCBI BLink).&nbsp AT5G59500 AT5G59500.1 TTAGCCCATAGGCCCATTg unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae – 22; Bacteria – 353; Metazoa – 4; Fungi – 21; Plants – 20; Viruses – 0; Other Eukaryotes – 71 (source: NCBI BLink).&nbsp AT5G59970 AT5G59970.1 ATAACCGGCCCATTAA histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59690.1); Has 2716 Blast hits to 2716 proteins in 361 species: Archae – 0; Bacteria – 0; Metazoa – 1566; Fungi – 282; Plants – 355; Viruses – 6; Other Eukaryotes – 507 (source: NCBI BLink).&nbsp AT5G60140 AT5G60140.1 TTAAGGCCCATTT transcriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT5G60130.1); Has 35622 Blast hits to 9758 proteins in 600 species: Archae – 149; Bacteria – 18835; Metazoa – 6044; Fungi – 2604; Plants – 1070; Viruses – 420; Other Eukaryotes – 6500 (source: NCBI BLink).&nbsp AT5G60160 AT5G60160.1 CAATTGGGCTTTGTAATGGGCCAAT aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae – 1; Bacteria – 687; Metazoa – 123; Fungi – 173; Plants – 41; Viruses – 0; Other Eukaryotes – 253 (source: NCBI BLink).&nbsp AT5G60620 AT5G60620.1 ATAATGGGCCTGA phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: triglyceride biosynthetic process, diacylglycerol biosynthetic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G80950.1); Has 820 Blast hits to 786 proteins in 139 species: Archae – 0; Bacteria – 81; Metazoa – 535; Fungi – 2; Plants – 72; Viruses – 0; Other Eukaryotes – 130 (source: NCBI BLink).&nbsp AT5G60820 AT5G60820.1 TTCGGCCCATTAG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae – 0; Bacteria – 123; Metazoa – 2390; Fungi – 543; Plants – 2247; Viruses – 74; Other Eukaryotes – 1423 (source: NCBI BLink).&nbsp AT5G60940 AT5G60940.1 ATAGGCCCATTAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae – 44; Bacteria – 4154; Metazoa – 11377; Fungi – 4590; Plants – 1838; Viruses – 0; Other Eukaryotes – 3424 (source: NCBI BLink).&nbsp AT5G60940.1 CAAAGGCCCATTAG transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae – 44; Bacteria – 4154; Metazoa – 11377; Fungi – 4590; Plants – 1838; Viruses – 0; Other Eukaryotes – 3424 (source: NCBI BLink).&nbsp AT5G60940.2 ATAGGCCCATTAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae – 44; Bacteria – 4154; Metazoa – 11377; Fungi – 4590; Plants – 1838; Viruses – 0; Other Eukaryotes – 3424 (source: NCBI BLink).&nbsp AT5G60940.2 CAAAGGCCCATTAG transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae – 44; Bacteria – 4154; Metazoa – 11377; Fungi – 4590; Plants – 1838; Viruses – 0; Other Eukaryotes – 3424 (source: NCBI BLink).&nbsp AT5G61865 AT5G61865.1 ATAATGGGCCUNE unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae – 3; Bacteria – 6; Metazoa – 23; Fungi – 3; Plants – 4; Viruses – 0; Other Eukaryotes – 12 (source: NCBI BLink).&nbsp AT5G61970 AT5G61970.1 TAAATGGGCCTGG signal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae – 2; Bacteria – 4; Metazoa – 134; Fungi – 62; Plants – 27; Viruses – 0; Other Eukaryotes – 57 (source: NCBI BLink).&nbsp AT5G62070 AT5G62070.1 TCAGGCCCATTGACTTTAACCG IQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae – 0; Bacteria – 0; Metazoa – 46; Fungi – 4; Plants – 406; Viruses – 0; Other Eukaryotes – 6 (source: NCBI BLink).&nbsp AT5G63080 AT5G63080.1 ATAATGGGCCTATAAATGGGCCGTA transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1321 Blast hits to 1316 proteins in 215 species: Archae – 0; Bacteria – 213; Metazoa – 766; Fungi – 131; Plants – 81; Viruses – 0; Other Eukaryotes – 130 (source: NCBI BLink).&nbsp AT5G63190 AT5G63190.1 CAATGGGCCGAA MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae – 0; Bacteria – 0; Metazoa – 1077; Fungi – 6; Plants – 322; Viruses – 0; Other Eukaryotes – 91 (source: NCBI BLink).&nbsp AT5G63190.2 CAATGGGCCGAA MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae – 0; Bacteria – 0; Metazoa – 1077; Fungi – 6; Plants – 322; Viruses – 0; Other Eukaryotes – 91 (source: NCBI BLink).&nbsp AT5G63520 AT5G63520.1 ATAATGGGCCTATT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae – 0; Bacteria – 72; Metazoa – 6; Fungi – 0; Plants – 7; Viruses – 0; Other Eukaryotes – 11 (source: NCBI BLink).&nbsp AT5G63890 AT5G63890.1 AAAGGCCCATTC Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.&nbsp AT5G63890.2 AAAGGCCCATTC Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.&nbsp AT5G64140 AT5G64140.1 GTGGCCCATTTA Encodes a putative ribosomal protein S28.&nbsp AT5G64350 AT5G64350.1 ATAATGGGCCTAAA FK506-BINDING PROTEIN (FKBP12); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related (TAIR:AT4G25340.1); Has 5723 Blast hits to 5615 proteins in 1032 species: Archae – 25; Bacteria – 2709; Metazoa – 1179; Fungi – 351; Plants – 350; Viruses – 0; Other Eukaryotes – 1109 (source: NCBI BLink).&nbsp AT5G64360 AT5G64360.1 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.1 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.2 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.2 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.3 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.3 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.4 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64360.4 DCGGCCCATTg DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G09540.1); Has 1613 Blast hits to 1606 proteins in 464 species: Archae – 35; Bacteria – 630; Metazoa – 430; Fungi – 74; Plants – 291; Viruses – 0; Other Eukaryotes – 153 (source: NCBI BLink).&nbsp AT5G64650 AT5G64650.1 DCGGCCCATTg ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5414 Blast hits to 5398 proteins in 1517 species: Archae – 0; Bacteria – 3033; Metazoa – 81; Fungi – 83; Plants – 73; Viruses – 0; Other Eukaryotes – 2144 (source: NCBI BLink).&nbsp AT5G64680 AT5G64680.1 TTAAAGGCCCATTATGGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.&nbsp AT5G64680.2 TTAAAGGCCCATTATGGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.&nbsp AT5G64680.3 TTAAAGGCCCATTATGGCCCAAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.&nbsp AT5G65110 AT5G65110.1 CTTAATGGGCCAC Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.&nbsp AT5G65110.2 CTTAATGGGCCAC Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.&nbsp AT5G65260 AT5G65260.1 AATTGGGCCTTATTAGGCCCATTAAG polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae – 6; Bacteria – 543; Metazoa – 2461; Fungi – 1041; Plants – 837; Viruses – 0; Other Eukaryotes – 645 (source: NCBI BLink).&nbsp AT5G65270 AT5G65270.1 CTTAATGGGCCTAATAAGGCCCAATT Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae – 17; Bacteria – 108; Metazoa – 12691; Fungi – 2978; Plants – 2157; Viruses – 19; Other Eukaryotes – 5059 (source: NCBI BLink).&nbsp AT5G65720 AT5G65720.1 TATAGGCCCATTAT cysteine desulfurase whose activity is dependent on AtSufE activation.&nbsp AT5G65720.2 TATAGGCCCATTAT cysteine desulfurase whose activity is dependent on AtSufE activation.&nbsp AT5G65950 AT5G65950.1 AGTGGGCTTATAATGGGCCTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae – 0; Bacteria – 0; Metazoa – 129; Fungi – 62; Plants – 23; Viruses – 0; Other Eukaryotes – 24 (source: NCBI BLink).&nbsp AT5G66030 AT5G66030.1 ATAATGGGCCTAAG Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.&nbsp AT5G66030.2 ATAATGGGCCTAAG Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.&nbsp AT5G66040 AT5G66040.2 CTTAGGCCCATTAT SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae – 32; Bacteria – 1489; Metazoa – 53; Fungi – 31; Plants – 139; Viruses – 0; Other Eukaryotes – 485 (source: NCBI BLink).&nbsp AT5G66055 AT5G66055.1 GTAAGGCCCATTAG ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae – 85; Bacteria – 4541; Metazoa – 37898; Fungi – 4361; Plants – 1873; Viruses – 1166; Other Eukaryotes – 20282 (source: NCBI BLink).&nbsp AT5G66055.1 TGAGGCCCATTg ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae – 85; Bacteria – 4541; Metazoa – 37898; Fungi – 4361; Plants – 1873; Viruses – 1166; Other Eukaryotes – 20282 (source: NCBI BLink).&nbsp AT5G66055.2 GTAAGGCCCATTAG ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae – 85; Bacteria – 4541; Metazoa – 37898; Fungi – 4361; Plants – 1873; Viruses – 1166; Other Eukaryotes – 20282 (source: NCBI BLink).&nbsp AT5G66055.2 TGAGGCCCATTg ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae – 85; Bacteria – 4541; Metazoa – 37898; Fungi – 4361; Plants – 1873; Viruses – 1166; Other Eukaryotes – 20282 (source: NCBI BLink).&nbsp AT5G66060 AT5G66060.1 CAATGGGCCTCA iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae – 0; Bacteria – 195; Metazoa – 891; Fungi – 57; Plants – 219; Viruses – 14; Other Eukaryotes – 403 (source: NCBI BLink).&nbsp AT5G66060.1 CTAATGGGCCTTAC iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae – 0; Bacteria – 195; Metazoa – 891; Fungi – 57; Plants – 219; Viruses – 14; Other Eukaryotes – 403 (source: NCBI BLink).&nbsp AT5G66140 AT5G66140.1 ATAAGGCCCATTTA Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation.&nbsp AT5G66140.1 TTAATGGGCCTGT Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation.&nbsp AT5G66450 AT5G66450.1 CAATGGGCCTATT phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae – 0; Bacteria – 6; Metazoa – 67; Fungi – 59; Plants – 45; Viruses – 0; Other Eukaryotes – 31 (source: NCBI BLink).&nbsp AT5G66450.2 CAATGGGCCTATT phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae – 0; Bacteria – 6; Metazoa – 67; Fungi – 59; Plants – 45; Viruses – 0; Other Eukaryotes – 31 (source: NCBI BLink).&nbsp AT5G66590 AT5G66590.1 TTAATGGGCCTGA allergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 1763 Blast hits to 1704 proteins in 235 species: Archae – 0; Bacteria – 47; Metazoa – 893; Fungi – 192; Plants – 589; Viruses – 0; Other Eukaryotes – 42 (source: NCBI BLink).&nbsp AT5G66680 AT5G66680.1 TTCGGCCCATTT Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins.&nbsp AT5G66910 AT5G66910.1 UNEAATGGGCCGTA disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae – 22; Bacteria – 1182; Metazoa – 2936; Fungi – 103; Plants – 14487; Viruses – 0; Other Eukaryotes – 693 (source: NCBI BLink).&nbsp AT5G66910.1 CAATGGGCCTGA disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae – 22; Bacteria – 1182; Metazoa – 2936; Fungi – 103; Plants – 14487; Viruses – 0; Other Eukaryotes – 693 (source: NCBI BLink).&nbsp AT5G66930 AT5G66930.1 UNEAATGGGCCAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445).&nbsp AT5G66930.2 UNEAATGGGCCAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445).&nbsp AT5G67070 AT5G67070.1 TGGCCCATTAA Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.&nbsp AT5G67100 AT5G67100.1 GTAAGGCCCATTAAG Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering.&nbsp AT5G67150 AT5G67150.1 ATAATGGGCCTAG transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae – 0; Bacteria – 0; Metazoa – 0; Fungi – 151; Plants – 1216; Viruses – 0; Other Eukaryotes – 0 (source: NCBI BLink).&nbsp AT5G67320 AT5G67320.1 ATAGGCCCATTUNE Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing.&nbsp AT5G67370 AT5G67370.1 UNEAATGGGCCAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae – 0; Bacteria – 98; Metazoa – 0; Fungi – 0; Plants – 35; Viruses – 0; Other Eukaryotes – 131 (source: NCBI BLink).&nbsp
AtREG361 | LIMITED TIME OFFER !
4.9 (99%) 39 votes
 

Leave a Reply